Mutagenetix > Incidental Mutations

Incidental Mutation 'R4506:Piwil4'

332021

Institutional Source

Beutler Lab

Gene Symbol

Piwil4

Ensembl Gene

ENSMUSG00000036912

Gene Name

piwi-like RNA-mediated gene silencing 4

Synonyms

Miwi2, 9230101H05Rik, MIWI2

MMRRC Submission

041584-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14696230-14740733 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14725963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 352 (T352A)

Ref Sequence

ENSEMBL: ENSMUSP00000076213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076946
AA Change: T352A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: T352A

Domain	Start	End	E-Value	Type
Pfam:ArgoN	155	300	3.7e-11	PFAM
PAZ	313	450	2.55e-67	SMART
Piwi	614	864	8.98e-95	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115644
AA Change: T305A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: T305A

Domain	Start	End	E-Value	Type
Pfam:ArgoN	92	245	6.5e-10	PFAM
PAZ	266	403	2.55e-67	SMART
Piwi	541	834	6.71e-126	SMART

Meta Mutation Damage Score

0.5736

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Piwil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Piwil4	APN	9	14703097	missense	probably damaging	1.00
IGL00331:Piwil4	APN	9	14715031	splice site	probably benign
IGL00848:Piwil4	APN	9	14727411	missense	probably damaging	0.98
IGL00920:Piwil4	APN	9	14727437	missense	probably damaging	1.00
IGL01583:Piwil4	APN	9	14734487	missense	probably damaging	1.00
IGL01690:Piwil4	APN	9	14703095	missense	probably damaging	1.00
IGL01763:Piwil4	APN	9	14706266	splice site	probably null
IGL02103:Piwil4	APN	9	14725986	splice site	probably null
IGL02898:Piwil4	APN	9	14706287	unclassified	probably benign
IGL03037:Piwil4	APN	9	14705012	missense	possibly damaging	0.88
IGL03352:Piwil4	APN	9	14725887	missense	probably damaging	1.00
PIT4651001:Piwil4	UTSW	9	14708899	missense	possibly damaging	0.48
R0453:Piwil4	UTSW	9	14727452	missense	probably benign	0.00
R2324:Piwil4	UTSW	9	14736908	missense	possibly damaging	0.88
R3236:Piwil4	UTSW	9	14700248	unclassified	probably benign
R3408:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R3689:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R3844:Piwil4	UTSW	9	14729960	missense	possibly damaging	0.54
R4191:Piwil4	UTSW	9	14715000	missense	probably damaging	0.99
R4505:Piwil4	UTSW	9	14725963	missense	probably damaging	1.00
R4541:Piwil4	UTSW	9	14718316	missense	probably damaging	1.00
R4652:Piwil4	UTSW	9	14712308	nonsense	probably null
R4876:Piwil4	UTSW	9	14740465	missense	probably benign	0.22
R5027:Piwil4	UTSW	9	14709944	missense	probably damaging	1.00
R5479:Piwil4	UTSW	9	14705041	missense	probably damaging	1.00
R6656:Piwil4	UTSW	9	14709934	missense	probably damaging	1.00
R6736:Piwil4	UTSW	9	14715823	missense	probably benign
R7096:Piwil4	UTSW	9	14736816	nonsense	probably null
R7124:Piwil4	UTSW	9	14736900	missense	probably benign
R7358:Piwil4	UTSW	9	14729993	missense	possibly damaging	0.82
R7371:Piwil4	UTSW	9	14727433	missense	probably benign	0.08
R7419:Piwil4	UTSW	9	14702395	missense	probably damaging	1.00
R7467:Piwil4	UTSW	9	14705041	missense	probably damaging	1.00
R7571:Piwil4	UTSW	9	14734597	missense	probably benign	0.08
R7644:Piwil4	UTSW	9	14734415	splice site	probably null
R7992:Piwil4	UTSW	9	14703149	missense
R8284:Piwil4	UTSW	9	14727478	missense	probably benign	0.00
R8679:Piwil4	UTSW	9	14705026	missense
R8777:Piwil4	UTSW	9	14739389	critical splice donor site	probably null
R8777-TAIL:Piwil4	UTSW	9	14739389	critical splice donor site	probably null
R8824:Piwil4	UTSW	9	14727475	missense	probably benign	0.04
R8863:Piwil4	UTSW	9	14720087	missense	probably benign	0.03
X0026:Piwil4	UTSW	9	14740591	utr 5 prime	probably benign
X0064:Piwil4	UTSW	9	14708875	missense	probably benign	0.00
Z1088:Piwil4	UTSW	9	14734517	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTTGGAGAGGTCACAACC -3'
(R):5'- CTGTGTACTGAAGCGTTCACAC -3'

Sequencing Primer
(F):5'- GGTCACAACCACAAGAAAAGTG -3'
(R):5'- CTCTGTTGAGAGCTGATCCTGC -3'

Posted On

2015-07-21