Incidental Mutation 'R4506:Olfr160'
ID332023
Institutional Source Beutler Lab
Gene Symbol Olfr160
Ensembl Gene ENSMUSG00000061165
Gene Nameolfactory receptor 160
SynonymsGA_x6K02T2PVTD-31389446-31388517, MOR171-3, M72, MOR171-3
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37708964-37716250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37711464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 272 (V272I)
Ref Sequence ENSEMBL: ENSMUSP00000151178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104875] [ENSMUST00000211952] [ENSMUST00000215727]
Predicted Effect probably benign
Transcript: ENSMUST00000104875
AA Change: V272I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100468
Gene: ENSMUSG00000061165
AA Change: V272I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.5e-48 PFAM
Pfam:7tm_1 41 290 6.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211952
AA Change: V272I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215727
AA Change: V272I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele respond heterogeneously to odorants and display abnormal innervation of glomeruli by olfactory sensory axons in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Olfr160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Olfr160 APN 9 37711836 missense probably damaging 0.98
IGL02195:Olfr160 APN 9 37712121 missense probably benign
R0099:Olfr160 UTSW 9 37711454 missense probably damaging 0.99
R0124:Olfr160 UTSW 9 37711463 missense possibly damaging 0.79
R0129:Olfr160 UTSW 9 37711940 missense probably damaging 1.00
R0882:Olfr160 UTSW 9 37711872 missense probably benign 0.02
R1855:Olfr160 UTSW 9 37711970 missense possibly damaging 0.92
R1988:Olfr160 UTSW 9 37711697 missense possibly damaging 0.50
R2346:Olfr160 UTSW 9 37711365 missense possibly damaging 0.50
R4164:Olfr160 UTSW 9 37711698 missense probably benign 0.03
R4274:Olfr160 UTSW 9 37712068 missense probably damaging 1.00
R4504:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4505:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R5017:Olfr160 UTSW 9 37711525 nonsense probably null
R5268:Olfr160 UTSW 9 37712004 missense probably damaging 1.00
R5316:Olfr160 UTSW 9 37711685 missense possibly damaging 0.90
R5372:Olfr160 UTSW 9 37711938 missense possibly damaging 0.49
R5385:Olfr160 UTSW 9 37712021 missense probably damaging 1.00
R5822:Olfr160 UTSW 9 37711791 missense probably benign 0.01
R5906:Olfr160 UTSW 9 37711805 missense probably benign 0.23
R5990:Olfr160 UTSW 9 37712110 missense probably damaging 0.99
R6842:Olfr160 UTSW 9 37711589 missense probably benign
R7712:Olfr160 UTSW 9 37712133 missense probably damaging 1.00
R8132:Olfr160 UTSW 9 37712073 missense probably benign 0.41
Z1177:Olfr160 UTSW 9 37711564 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTCTGTACACAGTTGGGC -3'
(R):5'- AGTTACCAGCTTAACCGTACTC -3'

Sequencing Primer
(F):5'- TACACAGTTGGGCAAGCTTG -3'
(R):5'- AGCTTAACCGTACTCATTTCCTATG -3'
Posted On2015-07-21