Mutagenetix > Incidental Mutation

Incidental Mutation 'R4506:Adam19'

332026

Institutional Source

Beutler Lab

Gene Symbol

Adam19

Ensembl Gene

ENSMUSG00000011256

Gene Name

a disintegrin and metallopeptidase domain 19 (meltrin beta)

Synonyms

Mltnb

MMRRC Submission

041584-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46055992-46147343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46118444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 232 (D232N)

Ref Sequence

ENSEMBL: ENSMUSP00000011400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011400]

AlphaFold

O35674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011400
AA Change: D232N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: D232N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	163	9.4e-27	PFAM
Pfam:Reprolysin_5	209	388	1.9e-25	PFAM
Pfam:Reprolysin_4	209	399	1.5e-15	PFAM
Pfam:Reprolysin	211	409	1.3e-68	PFAM
Pfam:Reprolysin_2	231	399	6.1e-19	PFAM
Pfam:Reprolysin_3	235	357	1.2e-19	PFAM
DISIN	426	501	9.7e-41	SMART
ACR	502	650	7.46e-62	SMART
transmembrane domain	704	726	N/A	INTRINSIC
low complexity region	788	797	N/A	INTRINSIC
low complexity region	832	846	N/A	INTRINSIC
low complexity region	886	905	N/A	INTRINSIC

Meta Mutation Damage Score

0.0934

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Adam19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Adam19	APN	11	46112783	missense	probably damaging	1.00
IGL01727:Adam19	APN	11	46121553	missense	probably benign
IGL01758:Adam19	APN	11	46112924	missense	probably benign	0.01
IGL02160:Adam19	APN	11	46139695	missense	probably damaging	0.99
IGL02421:Adam19	APN	11	46137553	missense	probably damaging	0.96
IGL02572:Adam19	APN	11	46131721	nonsense	probably null
IGL02995:Adam19	APN	11	46136349	missense	probably benign	0.00
IGL03171:Adam19	APN	11	46138854	missense	probably damaging	0.98
IGL03237:Adam19	APN	11	46137556	missense	probably benign
R0003:Adam19	UTSW	11	46128789	missense	probably damaging	1.00
R0026:Adam19	UTSW	11	46136259	missense	probably damaging	1.00
R0158:Adam19	UTSW	11	46143034	missense	probably damaging	1.00
R0304:Adam19	UTSW	11	46127392	missense	possibly damaging	0.91
R0488:Adam19	UTSW	11	46138930	missense	probably damaging	0.98
R0501:Adam19	UTSW	11	46123130	missense	probably damaging	1.00
R0591:Adam19	UTSW	11	46121411	splice site	probably benign
R0734:Adam19	UTSW	11	46127403	missense	probably damaging	0.99
R0747:Adam19	UTSW	11	46118495	splice site	probably null
R0771:Adam19	UTSW	11	46121453	missense	possibly damaging	0.92
R1052:Adam19	UTSW	11	46127265	missense	probably damaging	0.99
R1573:Adam19	UTSW	11	46113618	splice site	probably benign
R1735:Adam19	UTSW	11	46138917	missense	probably benign	0.26
R1830:Adam19	UTSW	11	46127278	missense	probably damaging	0.98
R1911:Adam19	UTSW	11	46121454	missense	probably damaging	1.00
R2092:Adam19	UTSW	11	46060904	splice site	probably null
R3749:Adam19	UTSW	11	46137610	missense	probably benign	0.00
R3893:Adam19	UTSW	11	46128838	missense	probably damaging	1.00
R3916:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R3917:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R4767:Adam19	UTSW	11	46138977	critical splice donor site	probably null
R5055:Adam19	UTSW	11	46123169	missense	probably damaging	1.00
R5313:Adam19	UTSW	11	46131776	missense	probably damaging	1.00
R5329:Adam19	UTSW	11	46125026	missense	probably damaging	0.99
R5567:Adam19	UTSW	11	46136250	missense	probably damaging	1.00
R5602:Adam19	UTSW	11	46136315	missense	probably benign
R6198:Adam19	UTSW	11	46121502	missense	probably damaging	1.00
R6875:Adam19	UTSW	11	46112875	missense	probably benign
R7011:Adam19	UTSW	11	46143018	missense	probably benign	0.00
R7163:Adam19	UTSW	11	46131717	missense	probably benign
R7213:Adam19	UTSW	11	46121471	missense	probably benign	0.20
R7267:Adam19	UTSW	11	46121576	nonsense	probably null
R7896:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
R8012:Adam19	UTSW	11	46065046	missense	possibly damaging	0.74
R8059:Adam19	UTSW	11	46136466	splice site	probably benign
R8243:Adam19	UTSW	11	46125082	missense	probably damaging	1.00
R8357:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R8419:Adam19	UTSW	11	46125023	missense	possibly damaging	0.77
R8457:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R9163:Adam19	UTSW	11	46127349	missense	probably benign	0.02
R9349:Adam19	UTSW	11	46131743	nonsense	probably null
R9489:Adam19	UTSW	11	46137622	missense	probably benign	0.10
R9579:Adam19	UTSW	11	46118435	missense	probably benign	0.00
R9641:Adam19	UTSW	11	46136322	missense	probably damaging	1.00
X0067:Adam19	UTSW	11	46056115	start codon destroyed	probably null	0.06

Predicted Primers

PCR Primer
(F):5'- ATCACATCTGCTCTGGTTGC -3'
(R):5'- GACCCAAGAAGCTGAGTTGTTTG -3'

Sequencing Primer
(F):5'- CTTCCTTGCCCTGGGAGATG -3'
(R):5'- GCCTCTGGTTGATAGCTCAG -3'

Posted On

2015-07-21