Incidental Mutation 'R4506:Olfr393'
ID 332028
Institutional Source Beutler Lab
Gene Symbol Olfr393
Ensembl Gene ENSMUSG00000094488
Gene Name olfactory receptor 393
Synonyms GA_x6K02T2P1NL-4004140-4003208, MOR135-7
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R4506 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 73844413-73851454 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 73847695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 143 (C143*)
Ref Sequence ENSEMBL: ENSMUSP00000150031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102523] [ENSMUST00000213365]
AlphaFold Q8VGR6
Predicted Effect probably null
Transcript: ENSMUST00000102523
AA Change: C143*
SMART Domains Protein: ENSMUSP00000099582
Gene: ENSMUSG00000094488
AA Change: C143*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.5e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.3e-7 PFAM
Pfam:7tm_1 41 290 4.8e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213365
AA Change: C143*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Olfr393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Olfr393 APN 11 73847210 missense probably benign 0.00
IGL01845:Olfr393 APN 11 73847472 missense probably damaging 1.00
IGL01969:Olfr393 APN 11 73847609 missense possibly damaging 0.56
IGL02288:Olfr393 APN 11 73847381 missense possibly damaging 0.88
IGL02726:Olfr393 APN 11 73847865 missense probably benign 0.02
R0400:Olfr393 UTSW 11 73848041 missense probably benign 0.15
R1672:Olfr393 UTSW 11 73847955 missense probably benign 0.31
R1816:Olfr393 UTSW 11 73847199 missense probably benign 0.00
R2294:Olfr393 UTSW 11 73847486 missense probably damaging 1.00
R4587:Olfr393 UTSW 11 73847219 missense probably benign 0.12
R4593:Olfr393 UTSW 11 73847314 missense probably benign 0.22
R5216:Olfr393 UTSW 11 73847436 missense probably damaging 0.97
R5657:Olfr393 UTSW 11 73847540 missense probably damaging 1.00
R5763:Olfr393 UTSW 11 73847867 missense probably benign 0.01
R5912:Olfr393 UTSW 11 73847675 missense possibly damaging 0.61
R6025:Olfr393 UTSW 11 73847919 missense probably benign 0.23
R6630:Olfr393 UTSW 11 73847876 missense probably benign
R6804:Olfr393 UTSW 11 73847414 missense probably benign 0.00
R7363:Olfr393 UTSW 11 73847915 missense probably damaging 1.00
R7860:Olfr393 UTSW 11 73847507 missense probably benign 0.07
R8103:Olfr393 UTSW 11 73847909 missense probably damaging 1.00
R8158:Olfr393 UTSW 11 73847871 missense probably benign 0.01
R8835:Olfr393 UTSW 11 73847876 missense probably benign
R8925:Olfr393 UTSW 11 73847580 missense probably benign 0.03
R8927:Olfr393 UTSW 11 73847580 missense probably benign 0.03
R8960:Olfr393 UTSW 11 73847341 nonsense probably null
R9221:Olfr393 UTSW 11 73847282 missense probably damaging 1.00
R9355:Olfr393 UTSW 11 73847817 missense probably damaging 0.98
Z1177:Olfr393 UTSW 11 73847801 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCCTTGAGTAGATGGAACTTTAAG -3'
(R):5'- TAATATGCAGAGCCAGGACCC -3'

Sequencing Primer
(F):5'- TTGAGTAGATGGAACTTTAAGAATGG -3'
(R):5'- GGACCCATCCATCCCCTATG -3'
Posted On 2015-07-21