Mutagenetix > Incidental Mutation

Incidental Mutation 'R4506:Ace'

332029

Institutional Source

Beutler Lab

Gene Symbol

Ace

Ensembl Gene

ENSMUSG00000020681

Gene Name

angiotensin I converting enzyme (peptidyl-dipeptidase A) 1

Synonyms

CD143

MMRRC Submission

041584-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105967945-105989964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105976666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 152 (L152Q)

Ref Sequence

ENSEMBL: ENSMUSP00000001964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]

AlphaFold

P09470

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001963
AA Change: L732Q

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: L732Q

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Peptidase_M2	45	628	7.1e-257	PFAM
Pfam:Peptidase_M2	648	1226	8.9e-261	PFAM
transmembrane domain	1264	1286	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000001964
AA Change: L152Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681
AA Change: L152Q

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Peptidase_M2	59	653	N/A	PFAM
transmembrane domain	684	706	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130673

Predicted Effect

unknown
Transcript: ENSMUST00000132280
AA Change: L498Q

SMART Domains

Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681
AA Change: L498Q

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M2	1	395	2.4e-201	PFAM
Pfam:Peptidase_M2	415	993	1.4e-261	PFAM
low complexity region	999	1014	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151657

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152925

Meta Mutation Damage Score

0.5871

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Ace

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00941:Ace	APN	11	105979550	missense	probably benign	0.21
IGL01105:Ace	APN	11	105972059	missense	probably damaging	1.00
IGL01761:Ace	APN	11	105979493	missense	possibly damaging	0.70
IGL01888:Ace	APN	11	105968944	missense	probably benign
IGL02173:Ace	APN	11	105988991	missense	probably benign	0.04
IGL02179:Ace	APN	11	105969789	missense	probably benign	0.16
IGL02331:Ace	APN	11	105971344	missense	possibly damaging	0.61
IGL02333:Ace	APN	11	105971447	missense	probably benign
IGL02556:Ace	APN	11	105972527	missense	probably damaging	1.00
IGL02576:Ace	APN	11	105974111	missense	probably damaging	1.00
IGL03202:Ace	APN	11	105976962	missense	probably damaging	1.00
R0403:Ace	UTSW	11	105973880	splice site	probably null
R0709:Ace	UTSW	11	105981538	missense	probably damaging	0.97
R1555:Ace	UTSW	11	105974901	splice site	probably null
R1603:Ace	UTSW	11	105972099	missense	probably benign	0.23
R1644:Ace	UTSW	11	105985106	missense	probably damaging	1.00
R1834:Ace	UTSW	11	105986094	splice site	probably benign
R2074:Ace	UTSW	11	105976623	nonsense	probably null
R3025:Ace	UTSW	11	105974093	splice site	probably null
R3176:Ace	UTSW	11	105976702	missense	probably null	1.00
R3276:Ace	UTSW	11	105976702	missense	probably null	1.00
R3977:Ace	UTSW	11	105981838	missense	possibly damaging	0.96
R4598:Ace	UTSW	11	105981759	splice site	probably null
R4914:Ace	UTSW	11	105979597	missense	probably damaging	1.00
R4968:Ace	UTSW	11	105981853	missense	possibly damaging	0.93
R5137:Ace	UTSW	11	105974826	missense	probably damaging	1.00
R5274:Ace	UTSW	11	105968037	missense	probably benign
R5332:Ace	UTSW	11	105973879	critical splice donor site	probably null
R5388:Ace	UTSW	11	105988458	missense	possibly damaging	0.85
R5425:Ace	UTSW	11	105973428	missense	probably damaging	1.00
R5640:Ace	UTSW	11	105970685	missense	probably damaging	1.00
R5838:Ace	UTSW	11	105972880	missense	probably benign	0.00
R6041:Ace	UTSW	11	105975308	missense	probably benign	0.27
R6083:Ace	UTSW	11	105985267	nonsense	probably null
R6106:Ace	UTSW	11	105989012	missense	probably damaging	1.00
R6225:Ace	UTSW	11	105979619	missense	possibly damaging	0.51
R6607:Ace	UTSW	11	105972377	missense	possibly damaging	0.82
R6918:Ace	UTSW	11	105972943	missense	probably damaging	1.00
R7330:Ace	UTSW	11	105986061	missense	probably damaging	1.00
R7471:Ace	UTSW	11	105973482	missense	probably damaging	1.00
R7709:Ace	UTSW	11	105988837	missense	probably benign	0.01
R7800:Ace	UTSW	11	105986058	missense	probably damaging	1.00
R7855:Ace	UTSW	11	105972379	missense	probably benign	0.05
R7947:Ace	UTSW	11	105973054	missense	possibly damaging	0.81
R8063:Ace	UTSW	11	105971364	missense	possibly damaging	0.90
R8072:Ace	UTSW	11	105972959	missense	probably damaging	0.98
R8412:Ace	UTSW	11	105979266	missense	probably benign
R8544:Ace	UTSW	11	105971290	critical splice acceptor site	probably null
R8695:Ace	UTSW	11	105985145	missense	probably benign	0.00
R8731:Ace	UTSW	11	105970600	missense	possibly damaging	0.93
R8855:Ace	UTSW	11	105970598	nonsense	probably null
R9087:Ace	UTSW	11	105981919	missense	probably damaging	1.00
R9149:Ace	UTSW	11	105972473	missense	possibly damaging	0.57
R9347:Ace	UTSW	11	105974132	missense	probably damaging	1.00
R9590:Ace	UTSW	11	105985680	missense	probably benign	0.01
X0018:Ace	UTSW	11	105971384	missense	probably damaging	1.00
X0063:Ace	UTSW	11	105975638	missense	probably benign	0.07
Z1177:Ace	UTSW	11	105988134	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGGCAAAGATACCAGCC -3'
(R):5'- TGTTATGGGAATTGCAGAGACATG -3'

Sequencing Primer
(F):5'- TCAGGGCAAAGATACCAGCCTAATG -3'
(R):5'- TGAAGACAGGACCCCTATTATTAAG -3'

Posted On

2015-07-21