Incidental Mutation 'R4506:Ap5m1'
ID332031
Institutional Source Beutler Lab
Gene Symbol Ap5m1
Ensembl Gene ENSMUSG00000036291
Gene Nameadaptor-related protein complex 5, mu 1 subunit
SynonymsMudeng, 4932432K03Rik
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4506 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49066097-49094234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49073761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 96 (V96A)
Ref Sequence ENSEMBL: ENSMUSP00000154186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037473] [ENSMUST00000227410] [ENSMUST00000227431] [ENSMUST00000227608] [ENSMUST00000228238]
Predicted Effect probably damaging
Transcript: ENSMUST00000037473
AA Change: V96A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046536
Gene: ENSMUSG00000036291
AA Change: V96A

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
Pfam:Adap_comp_sub 196 476 3.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227410
Predicted Effect probably damaging
Transcript: ENSMUST00000227431
AA Change: V96A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227608
Predicted Effect probably benign
Transcript: ENSMUST00000227991
Predicted Effect probably damaging
Transcript: ENSMUST00000228238
AA Change: V96A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Ap5m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Ap5m1 APN 14 49073790 missense probably damaging 1.00
IGL01806:Ap5m1 APN 14 49080340 missense probably damaging 1.00
IGL02011:Ap5m1 APN 14 49081135 unclassified probably benign
IGL02165:Ap5m1 APN 14 49078728 missense possibly damaging 0.94
IGL02203:Ap5m1 APN 14 49080258 missense probably damaging 1.00
IGL02950:Ap5m1 APN 14 49073935 missense probably benign 0.44
IGL03123:Ap5m1 APN 14 49073761 missense probably damaging 1.00
IGL03368:Ap5m1 APN 14 49081136 unclassified probably benign
R1688:Ap5m1 UTSW 14 49080834 critical splice acceptor site probably null
R2113:Ap5m1 UTSW 14 49086248 missense probably damaging 1.00
R2184:Ap5m1 UTSW 14 49086295 missense probably damaging 1.00
R2220:Ap5m1 UTSW 14 49081095 missense probably damaging 1.00
R2971:Ap5m1 UTSW 14 49083882 nonsense probably null
R3425:Ap5m1 UTSW 14 49073683 missense probably damaging 0.99
R4679:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R4799:Ap5m1 UTSW 14 49081070 missense probably benign 0.08
R6365:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R6834:Ap5m1 UTSW 14 49073737 missense probably damaging 0.99
R7115:Ap5m1 UTSW 14 49086270 nonsense probably null
R7224:Ap5m1 UTSW 14 49080927 missense unknown
R7383:Ap5m1 UTSW 14 49074196 missense possibly damaging 0.77
R7539:Ap5m1 UTSW 14 49073557 missense probably damaging 1.00
R7866:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7897:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCGAGCCAAAGCCTTCAATG -3'
(R):5'- CTGTAGAAGCAAGTCAGGCAAC -3'

Sequencing Primer
(F):5'- GCCAAAGCCTTCAATGGAATG -3'
(R):5'- ACTGACTCAGTTTTGTGTGTAGGTC -3'
Posted On2015-07-21