Mutagenetix > Incidental Mutation

Incidental Mutation 'R4506:Parp4'

332033

Institutional Source

Beutler Lab

Gene Symbol

Parp4

Ensembl Gene

ENSMUSG00000054509

Gene Name

poly (ADP-ribose) polymerase family, member 4

Synonyms

p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik

MMRRC Submission

041584-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56575619-56659794 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56652304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1847 (N1847K)

Ref Sequence

ENSEMBL: ENSMUSP00000124258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161553]

AlphaFold

E9PYK3

Predicted Effect

unknown
Transcript: ENSMUST00000161553
AA Change: N1847K

SMART Domains

Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: N1847K

Domain	Start	End	E-Value	Type
BRCT	3	84	4.32e-9	SMART
low complexity region	97	104	N/A	INTRINSIC
SCOP:d1a26_1	252	352	2e-19	SMART
Pfam:PARP	371	559	1.8e-50	PFAM
VIT	600	728	1.5e-57	SMART
VWA	867	1030	6.08e-13	SMART
Blast:14_3_3	1149	1205	5e-10	BLAST
low complexity region	1255	1264	N/A	INTRINSIC
low complexity region	1348	1362	N/A	INTRINSIC
low complexity region	1371	1394	N/A	INTRINSIC
internal_repeat_1	1395	1416	4.48e-6	PROSPERO
Pfam:Drf_FH1	1443	1542	3.3e-15	PFAM
low complexity region	1553	1587	N/A	INTRINSIC
internal_repeat_2	1588	1608	2.45e-5	PROSPERO
low complexity region	1695	1708	N/A	INTRINSIC
low complexity region	1739	1750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162312

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Parp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Parp4	APN	14	56616460	missense	possibly damaging	0.82
IGL00571:Parp4	APN	14	56647353	missense	unknown
IGL00737:Parp4	APN	14	56584163	missense	probably damaging	0.99
IGL00793:Parp4	APN	14	56602877	missense	possibly damaging	0.73
IGL01108:Parp4	APN	14	56607440	missense	probably benign	0.01
IGL01131:Parp4	APN	14	56585760	splice site	probably benign
IGL01485:Parp4	APN	14	56622204	missense	possibly damaging	0.54
IGL01704:Parp4	APN	14	56602326	missense	probably damaging	0.99
IGL01993:Parp4	APN	14	56610788	missense	possibly damaging	0.82
IGL02125:Parp4	APN	14	56590502	missense	probably benign	0.33
IGL02851:Parp4	APN	14	56648869	missense	unknown
IGL02863:Parp4	APN	14	56648786	missense	unknown
IGL03065:Parp4	APN	14	56637869	missense	probably benign	0.09
IGL03117:Parp4	APN	14	56602856	missense	probably benign	0.17
IGL03271:Parp4	APN	14	56585625	missense	probably benign	0.10
IGL03309:Parp4	APN	14	56587808	missense	probably benign	0.11
IGL03408:Parp4	APN	14	56602408	missense	probably damaging	0.99
poisonous	UTSW	14	56635748	missense	possibly damaging	0.65
R0515_Parp4_195	UTSW	14	56613667	missense	probably damaging	1.00
toxic	UTSW	14	56629158	missense	probably benign	0.28
venomous	UTSW	14	56589898	missense	possibly damaging	0.92
virulent	UTSW	14	56587778	missense	probably damaging	0.97
R0278:Parp4	UTSW	14	56607523	missense	probably damaging	0.99
R0320:Parp4	UTSW	14	56588496	critical splice donor site	probably null
R0445:Parp4	UTSW	14	56602748	splice site	probably null
R0452:Parp4	UTSW	14	56648843	missense	unknown
R0511:Parp4	UTSW	14	56635715	splice site	probably benign
R0515:Parp4	UTSW	14	56613667	missense	probably damaging	1.00
R0608:Parp4	UTSW	14	56602404	missense	probably damaging	1.00
R0800:Parp4	UTSW	14	56589951	missense	probably benign	0.00
R0959:Parp4	UTSW	14	56648119	missense	unknown
R1207:Parp4	UTSW	14	56647882	missense	unknown
R1207:Parp4	UTSW	14	56647882	missense	unknown
R1342:Parp4	UTSW	14	56590397	missense	probably damaging	1.00
R1520:Parp4	UTSW	14	56598406	missense	probably damaging	1.00
R1565:Parp4	UTSW	14	56589872	splice site	probably benign
R1574:Parp4	UTSW	14	56602295	missense	probably damaging	0.98
R1574:Parp4	UTSW	14	56602295	missense	probably damaging	0.98
R1649:Parp4	UTSW	14	56590428	missense	possibly damaging	0.95
R1666:Parp4	UTSW	14	56624163	missense	possibly damaging	0.91
R1781:Parp4	UTSW	14	56627381	splice site	probably null
R1799:Parp4	UTSW	14	56648132	missense	unknown
R1823:Parp4	UTSW	14	56589872	splice site	probably benign
R1859:Parp4	UTSW	14	56648915	missense	unknown
R1919:Parp4	UTSW	14	56624017	missense	probably damaging	1.00
R2000:Parp4	UTSW	14	56613724	missense	probably damaging	0.98
R2032:Parp4	UTSW	14	56629096	missense	possibly damaging	0.71
R2034:Parp4	UTSW	14	56634263	missense	probably damaging	1.00
R2177:Parp4	UTSW	14	56659289	missense	unknown
R2291:Parp4	UTSW	14	56613817	missense	probably damaging	1.00
R2865:Parp4	UTSW	14	56613724	missense	probably damaging	0.98
R3012:Parp4	UTSW	14	56595416	critical splice donor site	probably null
R3841:Parp4	UTSW	14	56587778	missense	probably damaging	0.97
R3913:Parp4	UTSW	14	56620518	missense	probably damaging	1.00
R4064:Parp4	UTSW	14	56624140	missense	probably benign	0.06
R4201:Parp4	UTSW	14	56592391	missense	possibly damaging	0.95
R4288:Parp4	UTSW	14	56607494	missense	probably damaging	1.00
R4360:Parp4	UTSW	14	56629204	missense	possibly damaging	0.89
R4577:Parp4	UTSW	14	56590410	missense	probably benign	0.33
R4633:Parp4	UTSW	14	56647591	missense	unknown
R4762:Parp4	UTSW	14	56610810	missense	probably damaging	1.00
R4836:Parp4	UTSW	14	56585738	missense	probably benign	0.00
R4974:Parp4	UTSW	14	56589898	missense	possibly damaging	0.92
R5049:Parp4	UTSW	14	56635731	missense	possibly damaging	0.81
R5479:Parp4	UTSW	14	56624095	missense	probably benign	0.01
R5683:Parp4	UTSW	14	56647429	nonsense	probably null
R5884:Parp4	UTSW	14	56614750	missense	probably damaging	1.00
R5965:Parp4	UTSW	14	56624032	missense	probably benign	0.11
R6001:Parp4	UTSW	14	56641283	missense	probably benign	0.01
R6027:Parp4	UTSW	14	56629158	missense	probably benign	0.28
R6230:Parp4	UTSW	14	56607533	missense	probably damaging	1.00
R6242:Parp4	UTSW	14	56595399	nonsense	probably null
R6355:Parp4	UTSW	14	56602300	missense	possibly damaging	0.61
R6414:Parp4	UTSW	14	56627381	splice site	probably null
R6418:Parp4	UTSW	14	56620651	critical splice donor site	probably null
R6477:Parp4	UTSW	14	56647237	missense	probably benign	0.00
R6542:Parp4	UTSW	14	56647882	missense	unknown
R6759:Parp4	UTSW	14	56620490	missense	probably benign	0.10
R6995:Parp4	UTSW	14	56613739	missense	probably damaging	0.97
R7002:Parp4	UTSW	14	56602404	missense	probably damaging	1.00
R7026:Parp4	UTSW	14	56620592	missense	probably benign	0.01
R7062:Parp4	UTSW	14	56614759	missense	possibly damaging	0.48
R7101:Parp4	UTSW	14	56589973	missense	probably benign	0.02
R7124:Parp4	UTSW	14	56602799	missense	probably benign	0.11
R7162:Parp4	UTSW	14	56648876	missense	unknown
R7293:Parp4	UTSW	14	56647846	small deletion	probably benign
R7297:Parp4	UTSW	14	56647681	missense	not run
R7337:Parp4	UTSW	14	56602395	missense	probably damaging	1.00
R7539:Parp4	UTSW	14	56635755	missense	probably damaging	1.00
R7575:Parp4	UTSW	14	56637918	missense	probably benign	0.28
R7808:Parp4	UTSW	14	56635748	missense	possibly damaging	0.65
R7854:Parp4	UTSW	14	56659348	missense	unknown
R7960:Parp4	UTSW	14	56595251	splice site	probably null
R8152:Parp4	UTSW	14	56647246	missense	probably benign	0.00
R8344:Parp4	UTSW	14	56648729	missense	unknown
R8416:Parp4	UTSW	14	56587814	critical splice donor site	probably null
R8726:Parp4	UTSW	14	56629099	missense	probably benign	0.04
R8752:Parp4	UTSW	14	56648616	missense	unknown
R8804:Parp4	UTSW	14	56616443	nonsense	probably null
R9046:Parp4	UTSW	14	56627470	missense	probably damaging	0.98
R9176:Parp4	UTSW	14	56635817	missense	possibly damaging	0.54
R9303:Parp4	UTSW	14	56595333	frame shift	probably null
R9303:Parp4	UTSW	14	56614767	critical splice donor site	probably null
R9305:Parp4	UTSW	14	56595333	frame shift	probably null
R9305:Parp4	UTSW	14	56614767	critical splice donor site	probably null
R9360:Parp4	UTSW	14	56641318	critical splice donor site	probably null
R9430:Parp4	UTSW	14	56629216	missense	probably damaging	1.00
R9491:Parp4	UTSW	14	56595371	missense	probably damaging	0.99
R9729:Parp4	UTSW	14	56648431	missense	unknown
RF020:Parp4	UTSW	14	56647349	missense	unknown
Z1177:Parp4	UTSW	14	56592367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTGAGTAAGGGCATGTC -3'
(R):5'- AAAGCCAGCCTGCTCTACATA -3'

Sequencing Primer
(F):5'- GCATGTCTGTATTCAAGCCAGAG -3'
(R):5'- TACATAGAGAGTTCTAGGCTAGCCC -3'

Posted On

2015-07-21