Mutagenetix > Incidental Mutation

Incidental Mutation 'R4506:Map3k13'

332035

Institutional Source

Beutler Lab

Gene Symbol

Map3k13

Ensembl Gene

ENSMUSG00000033618

Gene Name

mitogen-activated protein kinase kinase kinase 13

Synonyms

MMRRC Submission

041584-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21794346-21933439 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21922178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 752 (S752G)

Ref Sequence

ENSEMBL: ENSMUSP00000156202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]

AlphaFold

Q1HKZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000042065
AA Change: S752G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: S752G

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
low complexity region	119	137	N/A	INTRINSIC
Pfam:Pkinase	167	406	3.1e-60	PFAM
Pfam:Pkinase_Tyr	167	406	2.4e-65	PFAM
coiled coil region	456	502	N/A	INTRINSIC
low complexity region	578	599	N/A	INTRINSIC
low complexity region	632	649	N/A	INTRINSIC
low complexity region	805	821	N/A	INTRINSIC
low complexity region	833	843	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231988
AA Change: S752G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000232240
AA Change: S752G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0610

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ip6k3	A	T	17: 27,145,180	L298Q	possibly damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Map3k13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Map3k13	APN	16	21921764	missense	probably benign	0.00
IGL01092:Map3k13	APN	16	21928016	missense	probably damaging	0.97
IGL01958:Map3k13	APN	16	21892123	missense	probably benign
IGL02444:Map3k13	APN	16	21914232	missense	probably benign	0.19
IGL02503:Map3k13	APN	16	21908704	missense	possibly damaging	0.50
IGL02712:Map3k13	APN	16	21905255	missense	probably damaging	0.99
IGL03342:Map3k13	APN	16	21892231	missense	possibly damaging	0.94
R0086:Map3k13	UTSW	16	21914225	missense	probably damaging	0.98
R0124:Map3k13	UTSW	16	21903756	missense	possibly damaging	0.95
R0281:Map3k13	UTSW	16	21914157	missense	probably damaging	1.00
R0308:Map3k13	UTSW	16	21891988	missense	probably benign
R0601:Map3k13	UTSW	16	21905249	missense	possibly damaging	0.95
R0669:Map3k13	UTSW	16	21906524	missense	probably benign	0.03
R0918:Map3k13	UTSW	16	21926240	missense	probably damaging	1.00
R1641:Map3k13	UTSW	16	21903792	missense	probably damaging	1.00
R1838:Map3k13	UTSW	16	21914189	missense	possibly damaging	0.92
R1891:Map3k13	UTSW	16	21911086	missense	probably damaging	1.00
R2125:Map3k13	UTSW	16	21892144	missense	probably benign	0.01
R2332:Map3k13	UTSW	16	21898677	splice site	probably null
R2361:Map3k13	UTSW	16	21906536	missense	probably benign	0.05
R4395:Map3k13	UTSW	16	21898571	missense	possibly damaging	0.49
R4505:Map3k13	UTSW	16	21922178	missense	probably benign	0.00
R4521:Map3k13	UTSW	16	21905775	missense	possibly damaging	0.94
R4753:Map3k13	UTSW	16	21892002	missense	probably benign
R4952:Map3k13	UTSW	16	21911019	missense	probably benign	0.15
R5035:Map3k13	UTSW	16	21921671	missense	probably benign	0.03
R5327:Map3k13	UTSW	16	21921647	missense	possibly damaging	0.89
R5784:Map3k13	UTSW	16	21898641	missense	possibly damaging	0.68
R5831:Map3k13	UTSW	16	21928048	makesense	probably null
R5996:Map3k13	UTSW	16	21905245	missense	possibly damaging	0.95
R6007:Map3k13	UTSW	16	21905183	missense	possibly damaging	0.95
R6546:Map3k13	UTSW	16	21921777	missense	probably benign	0.15
R6620:Map3k13	UTSW	16	21892311	missense	possibly damaging	0.62
R6683:Map3k13	UTSW	16	21892312	missense	probably benign	0.32
R6692:Map3k13	UTSW	16	21905237	missense	possibly damaging	0.66
R6695:Map3k13	UTSW	16	21922278	missense	probably benign	0.10
R6743:Map3k13	UTSW	16	21892423	missense	probably damaging	0.98
R6822:Map3k13	UTSW	16	21922263	missense	probably benign	0.00
R6965:Map3k13	UTSW	16	21922150	missense	probably benign
R7149:Map3k13	UTSW	16	21925437	missense	probably benign	0.04
R7174:Map3k13	UTSW	16	21926256	missense	probably damaging	1.00
R7256:Map3k13	UTSW	16	21892238	missense	probably benign	0.03
R7400:Map3k13	UTSW	16	21922322	missense	probably damaging	1.00
R7733:Map3k13	UTSW	16	21921686	missense	probably damaging	1.00
R7848:Map3k13	UTSW	16	21905871	missense	probably damaging	0.98
R7871:Map3k13	UTSW	16	21921596	missense	probably benign	0.09
R7876:Map3k13	UTSW	16	21922319	missense	probably benign	0.00
R8002:Map3k13	UTSW	16	21905128	missense	probably benign	0.05
R8089:Map3k13	UTSW	16	21903817	missense	possibly damaging	0.48
R8341:Map3k13	UTSW	16	21921584	nonsense	probably null
R8738:Map3k13	UTSW	16	21926258	missense	probably damaging	1.00
R8940:Map3k13	UTSW	16	21908704	missense	possibly damaging	0.50
R8949:Map3k13	UTSW	16	21905132	missense	probably benign	0.05
R9391:Map3k13	UTSW	16	21921915	missense	probably benign	0.00
R9749:Map3k13	UTSW	16	21921831	missense	probably benign	0.00
R9802:Map3k13	UTSW	16	21921768	missense	possibly damaging	0.85
Z1176:Map3k13	UTSW	16	21905162	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACAAAGACAGATGCCTGG -3'
(R):5'- TCACCCTTTGATGTCAGAGACAG -3'

Sequencing Primer
(F):5'- ACAGATGCCTGGCTCAAGC -3'
(R):5'- CCTTTGATGTCAGAGACAGTCTACAC -3'

Posted On

2015-07-21