Mutagenetix > Incidental Mutations

Incidental Mutation 'R4506:Ip6k3'

332036

Institutional Source

Beutler Lab

Gene Symbol

Ip6k3

Ensembl Gene

ENSMUSG00000024210

Gene Name

inositol hexaphosphate kinase 3

Synonyms

D830007E07Rik, Ihpk3

MMRRC Submission

041584-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R4506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27143969-27167764 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27145180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 298 (L298Q)

Ref Sequence

ENSEMBL: ENSMUSP00000025046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025046]

AlphaFold

Q8BWD2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025046
AA Change: L298Q

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025046
Gene: ENSMUSG00000024210
AA Change: L298Q

Domain	Start	End	E-Value	Type
Pfam:IPK	193	390	3e-68	PFAM

Meta Mutation Damage Score

0.5434

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cerebellar Purkinje cell morphology, reduced synapse number, and defects in motor learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,261	P137T	probably damaging	Het
Abcc5	A	T	16: 20,333,695	I1367N	probably damaging	Het
Ace	T	A	11: 105,976,666	L152Q	probably damaging	Het
Adam19	G	A	11: 46,118,444	D232N	possibly damaging	Het
Anapc4	A	T	5: 52,835,730	N61I	possibly damaging	Het
Ap5m1	T	C	14: 49,073,761	V96A	probably damaging	Het
Atr	T	A	9: 95,865,237	C191S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cnot6l	A	T	5: 96,086,174	V326E	possibly damaging	Het
Fcer2a	A	T	8: 3,688,603		probably null	Het
Fgfr3	A	G	5: 33,729,999	T221A	probably damaging	Het
Gm6632	C	T	5: 59,054,478		noncoding transcript	Het
Gm8909	A	T	17: 36,161,480		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Itpr1	A	G	6: 108,432,686	D1727G	probably damaging	Het
Kdm2b	T	C	5: 122,888,625	T589A	possibly damaging	Het
Krtcap2	A	G	3: 89,246,256		probably benign	Het
Map3k13	A	G	16: 21,922,178	S752G	probably benign	Het
Mvb12a	G	T	8: 71,543,459	A86S	probably benign	Het
Nktr	T	A	9: 121,748,883		probably benign	Het
Olfr160	C	T	9: 37,711,464	V272I	probably benign	Het
Olfr393	A	T	11: 73,847,695	C143*	probably null	Het
Parp4	T	A	14: 56,652,304	N1847K	unknown	Het
Pcdhga8	G	C	18: 37,816,763	V411L	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Ric8a	A	G	7: 140,858,516	I223V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc7a5	A	T	8: 121,887,495		probably null	Het
Slc7a9	A	T	7: 35,453,420	T88S	probably damaging	Het
Tbrg1	T	A	9: 37,654,395	E87V	probably damaging	Het
Tnfsf4	T	C	1: 161,417,174	S145P	probably damaging	Het
Tomm34	C	A	2: 164,054,372		probably null	Het
Trpv3	A	G	11: 73,295,324	N647S	probably benign	Het
Upf1	G	A	8: 70,337,566	R637C	probably damaging	Het
Vmn2r23	A	T	6: 123,702,925	Q35H	probably damaging	Het
Wdtc1	C	T	4: 133,308,819	V137M	probably damaging	Het
Zfp276	G	A	8: 123,264,927		probably null	Het
Zfp90	C	T	8: 106,424,864	P403L	possibly damaging	Het

Other mutations in Ip6k3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01584:Ip6k3	APN	17	27151060	missense	probably benign
R0200:Ip6k3	UTSW	17	27145025	missense	probably damaging	1.00
R0220:Ip6k3	UTSW	17	27145229	missense	probably damaging	1.00
R1448:Ip6k3	UTSW	17	27145268	missense	possibly damaging	0.90
R1749:Ip6k3	UTSW	17	27145079	missense	probably benign	0.00
R1956:Ip6k3	UTSW	17	27151168	missense	probably benign	0.01
R1957:Ip6k3	UTSW	17	27151168	missense	probably benign	0.01
R3125:Ip6k3	UTSW	17	27157542	missense	probably damaging	1.00
R3798:Ip6k3	UTSW	17	27145106	missense	probably benign	0.01
R3806:Ip6k3	UTSW	17	27145000	missense	probably damaging	1.00
R4445:Ip6k3	UTSW	17	27145102	missense	probably benign	0.10
R4651:Ip6k3	UTSW	17	27145291	missense	probably damaging	1.00
R5972:Ip6k3	UTSW	17	27149960	missense	possibly damaging	0.48
R6119:Ip6k3	UTSW	17	27148625	missense	possibly damaging	0.72
R7140:Ip6k3	UTSW	17	27144995	missense	probably damaging	1.00
R7340:Ip6k3	UTSW	17	27148530	missense	probably benign	0.00
R7811:Ip6k3	UTSW	17	27157583	nonsense	probably null
R9105:Ip6k3	UTSW	17	27145195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCGAAGTCAATCATCCG -3'
(R):5'- AACAGGCAAGTTTGGTTTGG -3'

Sequencing Primer
(F):5'- GTCAATCATCCGGACATCAACTTTGG -3'
(R):5'- ACAGTGCCCAGTTTATGCAG -3'

Posted On

2015-07-21