Incidental Mutation 'R4506:Ip6k3'
ID 332036
Institutional Source Beutler Lab
Gene Symbol Ip6k3
Ensembl Gene ENSMUSG00000024210
Gene Name inositol hexaphosphate kinase 3
Synonyms D830007E07Rik, Ihpk3
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R4506 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27143969-27167764 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27145180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 298 (L298Q)
Ref Sequence ENSEMBL: ENSMUSP00000025046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025046]
AlphaFold Q8BWD2
Predicted Effect possibly damaging
Transcript: ENSMUST00000025046
AA Change: L298Q

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025046
Gene: ENSMUSG00000024210
AA Change: L298Q

DomainStartEndE-ValueType
Pfam:IPK 193 390 3e-68 PFAM
Meta Mutation Damage Score 0.5434 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cerebellar Purkinje cell morphology, reduced synapse number, and defects in motor learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Ip6k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Ip6k3 APN 17 27151060 missense probably benign
R0200:Ip6k3 UTSW 17 27145025 missense probably damaging 1.00
R0220:Ip6k3 UTSW 17 27145229 missense probably damaging 1.00
R1448:Ip6k3 UTSW 17 27145268 missense possibly damaging 0.90
R1749:Ip6k3 UTSW 17 27145079 missense probably benign 0.00
R1956:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R1957:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R3125:Ip6k3 UTSW 17 27157542 missense probably damaging 1.00
R3798:Ip6k3 UTSW 17 27145106 missense probably benign 0.01
R3806:Ip6k3 UTSW 17 27145000 missense probably damaging 1.00
R4445:Ip6k3 UTSW 17 27145102 missense probably benign 0.10
R4651:Ip6k3 UTSW 17 27145291 missense probably damaging 1.00
R5972:Ip6k3 UTSW 17 27149960 missense possibly damaging 0.48
R6119:Ip6k3 UTSW 17 27148625 missense possibly damaging 0.72
R7140:Ip6k3 UTSW 17 27144995 missense probably damaging 1.00
R7340:Ip6k3 UTSW 17 27148530 missense probably benign 0.00
R7811:Ip6k3 UTSW 17 27157583 nonsense probably null
R9105:Ip6k3 UTSW 17 27145195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCGAAGTCAATCATCCG -3'
(R):5'- AACAGGCAAGTTTGGTTTGG -3'

Sequencing Primer
(F):5'- GTCAATCATCCGGACATCAACTTTGG -3'
(R):5'- ACAGTGCCCAGTTTATGCAG -3'
Posted On 2015-07-21