Incidental Mutation 'R4506:Gm8909'
ID 332037
Institutional Source Beutler Lab
Gene Symbol Gm8909
Ensembl Gene ENSMUSG00000073402
Gene Name predicted gene 8909
Synonyms
MMRRC Submission 041584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R4506 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 36164443-36168537 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 36161480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040467] [ENSMUST00000097335] [ENSMUST00000173353]
AlphaFold G3UXE9
Predicted Effect probably benign
Transcript: ENSMUST00000040467
SMART Domains Protein: ENSMUSP00000036092
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 26 204 5.9e-96 PFAM
IGc1 223 294 8.23e-23 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090537
SMART Domains Protein: ENSMUSP00000088025
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 105 173 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097335
SMART Domains Protein: ENSMUSP00000094947
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 7.3e-96 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173025
SMART Domains Protein: ENSMUSP00000133655
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 148 216 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173353
SMART Domains Protein: ENSMUSP00000133663
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 3.9e-93 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174752
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Gm8909
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Gm8909 APN 17 36165354 critical splice donor site probably null
IGL00534:Gm8909 APN 17 36168129 missense probably damaging 1.00
IGL02312:Gm8909 APN 17 36165407 missense probably benign 0.01
IGL03346:Gm8909 APN 17 36168109 missense probably damaging 1.00
H8441:Gm8909 UTSW 17 36167982 missense possibly damaging 0.84
R0005:Gm8909 UTSW 17 36162192 unclassified probably benign
R0078:Gm8909 UTSW 17 36165461 missense possibly damaging 0.95
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0553:Gm8909 UTSW 17 36168057 missense probably damaging 1.00
R0670:Gm8909 UTSW 17 36168098 missense possibly damaging 0.74
R1718:Gm8909 UTSW 17 36161784 unclassified probably benign
R1937:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R2571:Gm8909 UTSW 17 36167661 missense possibly damaging 0.66
R4393:Gm8909 UTSW 17 36161969 unclassified probably benign
R4396:Gm8909 UTSW 17 36161969 unclassified probably benign
R4409:Gm8909 UTSW 17 36165850 missense possibly damaging 0.53
R4505:Gm8909 UTSW 17 36161480 unclassified probably benign
R4507:Gm8909 UTSW 17 36161480 unclassified probably benign
R4579:Gm8909 UTSW 17 36161757 unclassified probably benign
R4684:Gm8909 UTSW 17 36165858 missense possibly damaging 0.90
R4740:Gm8909 UTSW 17 36167556 missense probably damaging 1.00
R5087:Gm8909 UTSW 17 36165416 nonsense probably null
R5103:Gm8909 UTSW 17 36161685 unclassified probably benign
R5275:Gm8909 UTSW 17 36161675 splice site probably null
R5425:Gm8909 UTSW 17 36168485 missense probably damaging 1.00
R6155:Gm8909 UTSW 17 36167507 missense possibly damaging 0.93
R6727:Gm8909 UTSW 17 36165730 missense probably damaging 1.00
R6852:Gm8909 UTSW 17 36168073 missense possibly damaging 0.52
R7985:Gm8909 UTSW 17 36167553 missense probably damaging 1.00
R8316:Gm8909 UTSW 17 36168262 missense unknown
R8872:Gm8909 UTSW 17 36165401 missense probably benign 0.00
R9046:Gm8909 UTSW 17 36165143 critical splice donor site probably null
R9296:Gm8909 UTSW 17 36168277 missense unknown
Z1177:Gm8909 UTSW 17 36165712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATTGTAGGCTGTACTGC -3'
(R):5'- AATCTGAGATATGAGCCGCGTG -3'

Sequencing Primer
(F):5'- TACTGCCAGTACCCGTGGAG -3'
(R):5'- TGCGCCATGGATGAAGCTC -3'
Posted On 2015-07-21