Incidental Mutation 'R4507:Bmp3'
ID332047
Institutional Source Beutler Lab
Gene Symbol Bmp3
Ensembl Gene ENSMUSG00000029335
Gene Namebone morphogenetic protein 3
Synonyms9530029I04Rik
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location98854415-98884396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98879774 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 418 (I418L)
Ref Sequence ENSEMBL: ENSMUSP00000031278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031278] [ENSMUST00000200388]
Predicted Effect probably damaging
Transcript: ENSMUST00000031278
AA Change: I418L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031278
Gene: ENSMUSG00000029335
AA Change: I418L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 34 231 7.9e-9 PFAM
TGFB 366 468 6.17e-60 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200388
AA Change: H442L
SMART Domains Protein: ENSMUSP00000142907
Gene: ENSMUSG00000029335
AA Change: H442L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 40 227 1.4e-9 PFAM
TGFB 366 442 3.9e-11 SMART
Meta Mutation Damage Score 0.3067 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein suppresses osteoblast differentiation, and negatively regulates bone density, by modulating TGF-beta receptor availability to other ligands. Homozygous knockout mice for this gene exhibit increased bone density and volume, while overexpression of this gene in a transgenic mouse causes bone defects resulting in spontaneous rib fractures. This gene encodes distinct protein isoforms that may be similarly proteolytically processed. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in increased bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Bmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Bmp3 APN 5 98872379 missense possibly damaging 0.47
IGL02396:Bmp3 APN 5 98872719 missense possibly damaging 0.47
IGL03058:Bmp3 APN 5 98872094 missense probably damaging 1.00
IGL03189:Bmp3 APN 5 98872720 missense probably benign 0.23
IGL03400:Bmp3 APN 5 98872098 missense probably damaging 1.00
PIT4377001:Bmp3 UTSW 5 98879749 missense unknown
R0139:Bmp3 UTSW 5 98879909 missense possibly damaging 0.72
R0653:Bmp3 UTSW 5 98872111 missense probably damaging 1.00
R0881:Bmp3 UTSW 5 98872602 missense possibly damaging 0.95
R1261:Bmp3 UTSW 5 98879926 missense probably damaging 1.00
R1413:Bmp3 UTSW 5 98872405 missense probably damaging 0.98
R1481:Bmp3 UTSW 5 98872470 missense probably damaging 1.00
R3009:Bmp3 UTSW 5 98879837 missense probably damaging 1.00
R4750:Bmp3 UTSW 5 98872558 missense possibly damaging 0.89
R4833:Bmp3 UTSW 5 98855207 missense probably damaging 1.00
R4921:Bmp3 UTSW 5 98872061 missense probably damaging 1.00
R5022:Bmp3 UTSW 5 98872824 missense probably damaging 1.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R7179:Bmp3 UTSW 5 98872763 missense probably damaging 1.00
R7448:Bmp3 UTSW 5 98872218 missense probably damaging 0.96
R7880:Bmp3 UTSW 5 98872575 missense probably damaging 1.00
R7963:Bmp3 UTSW 5 98872575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCTAACAGGCGCTTTATAG -3'
(R):5'- AACTCGTGATTGGATGGAGC -3'

Sequencing Primer
(F):5'- CAGGCGCTTTATAGATGATACATCC -3'
(R):5'- AGCATCTGTGAGTTCTTGAAGAG -3'
Posted On2015-07-21