Incidental Mutation 'R4507:Parp11'
ID332050
Institutional Source Beutler Lab
Gene Symbol Parp11
Ensembl Gene ENSMUSG00000037997
Gene Namepoly (ADP-ribose) polymerase family, member 11
Synonyms5330431N24Rik, HIN1L
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location127446840-127494261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127474283 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 99 (R99G)
Ref Sequence ENSEMBL: ENSMUSP00000107814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039680] [ENSMUST00000112191] [ENSMUST00000112193] [ENSMUST00000112195] [ENSMUST00000144115]
Predicted Effect probably damaging
Transcript: ENSMUST00000039680
AA Change: R99G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036127
Gene: ENSMUSG00000037997
AA Change: R99G

DomainStartEndE-ValueType
Pfam:WWE 25 99 1.4e-18 PFAM
Pfam:PARP 129 331 4.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112191
AA Change: R16G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107810
Gene: ENSMUSG00000037997
AA Change: R16G

DomainStartEndE-ValueType
Pfam:PARP 46 248 4e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112193
AA Change: R99G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107812
Gene: ENSMUSG00000037997
AA Change: R99G

DomainStartEndE-ValueType
Pfam:WWE 22 99 4.5e-12 PFAM
Pfam:PARP 129 176 2.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112195
AA Change: R99G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107814
Gene: ENSMUSG00000037997
AA Change: R99G

DomainStartEndE-ValueType
Pfam:WWE 22 99 4.5e-12 PFAM
Pfam:PARP 129 176 2.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136945
Predicted Effect probably benign
Transcript: ENSMUST00000144115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201717
Meta Mutation Damage Score 0.4250 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired male fertility and teratozoospermia associated with sperm head malformations and nuclear envelope defects during the nuclear reshaping process of spermatid elongation and condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Parp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Parp11 APN 6 127471563 nonsense probably null
IGL01548:Parp11 APN 6 127491599 missense probably damaging 1.00
IGL01638:Parp11 APN 6 127491529 missense probably benign 0.13
IGL01688:Parp11 APN 6 127471606 missense probably benign 0.00
IGL03201:Parp11 APN 6 127490018 missense possibly damaging 0.80
IGL03297:Parp11 APN 6 127490082 splice site probably benign
H8786:Parp11 UTSW 6 127471635 missense probably damaging 1.00
R1514:Parp11 UTSW 6 127474293 missense possibly damaging 0.89
R1817:Parp11 UTSW 6 127490045 missense probably damaging 1.00
R1868:Parp11 UTSW 6 127470777 missense probably damaging 1.00
R1942:Parp11 UTSW 6 127470700 critical splice acceptor site probably null
R2011:Parp11 UTSW 6 127477891 missense probably benign 0.02
R4483:Parp11 UTSW 6 127471605 missense probably benign
R4593:Parp11 UTSW 6 127474299 missense probably benign 0.03
R5024:Parp11 UTSW 6 127471636 missense probably damaging 1.00
R5371:Parp11 UTSW 6 127470792 missense probably damaging 1.00
R6608:Parp11 UTSW 6 127477848 missense possibly damaging 0.93
R7606:Parp11 UTSW 6 127470760 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCTTAGATCAAGCACTGAAGG -3'
(R):5'- CTCCATCAGTGAACACGAGG -3'

Sequencing Primer
(F):5'- CCTTTGCAACATGATAAAAAGGTCAC -3'
(R):5'- CAGTGAACACGAGGTTTAATACTGC -3'
Posted On2015-07-21