Incidental Mutation 'R4507:Vat1l'
ID332057
Institutional Source Beutler Lab
Gene Symbol Vat1l
Ensembl Gene ENSMUSG00000046844
Gene Namevesicle amine transport protein 1 like
Synonyms
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4507 (G1)
Quality Score195
Status Validated
Chromosome8
Chromosomal Location114205612-114374071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114205816 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 34 (L34P)
Ref Sequence ENSEMBL: ENSMUSP00000116680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049509] [ENSMUST00000150963]
Predicted Effect probably benign
Transcript: ENSMUST00000049509
AA Change: L34P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053431
Gene: ENSMUSG00000046844
AA Change: L34P

DomainStartEndE-ValueType
Pfam:ADH_N 66 142 3.9e-14 PFAM
Pfam:ADH_zinc_N 190 302 1.4e-11 PFAM
Pfam:ADH_zinc_N_2 221 376 1.1e-14 PFAM
low complexity region 389 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142591
Predicted Effect probably benign
Transcript: ENSMUST00000150963
AA Change: L34P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116680
Gene: ENSMUSG00000046844
AA Change: L34P

DomainStartEndE-ValueType
Pfam:ADH_N 83 127 2.2e-6 PFAM
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Other mutations in Vat1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Vat1l APN 8 114369889 missense possibly damaging 0.89
IGL03379:Vat1l APN 8 114282266 missense probably damaging 0.98
R0504:Vat1l UTSW 8 114236579 splice site probably benign
R1222:Vat1l UTSW 8 114282361 splice site probably benign
R1418:Vat1l UTSW 8 114282361 splice site probably benign
R1859:Vat1l UTSW 8 114271301 missense probably damaging 1.00
R3777:Vat1l UTSW 8 114236800 critical splice donor site probably null
R3778:Vat1l UTSW 8 114236800 critical splice donor site probably null
R4154:Vat1l UTSW 8 114205803 missense possibly damaging 0.94
R4158:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4160:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4285:Vat1l UTSW 8 114205783 missense probably damaging 0.97
R5316:Vat1l UTSW 8 114284348 missense probably damaging 1.00
R6306:Vat1l UTSW 8 114371651 missense probably damaging 1.00
R7031:Vat1l UTSW 8 114271432 missense possibly damaging 0.60
R7162:Vat1l UTSW 8 114236778 missense probably damaging 0.99
R7378:Vat1l UTSW 8 114289392 missense possibly damaging 0.93
R7472:Vat1l UTSW 8 114236799 critical splice donor site probably null
R7662:Vat1l UTSW 8 114282344 missense probably damaging 1.00
RF032:Vat1l UTSW 8 114289329 missense probably damaging 1.00
RF035:Vat1l UTSW 8 114289329 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236622 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236623 missense probably damaging 1.00
Z1188:Vat1l UTSW 8 114205723 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATCCCACATTCAACAGGAGG -3'
(R):5'- AGCATCCCCAATCTAGGCTCTC -3'

Sequencing Primer
(F):5'- TTCAACAGGAGGAACCCGCG -3'
(R):5'- AGGCTCTCCCACCCACTG -3'
Posted On2015-07-21