Incidental Mutation 'R4507:Olfr877'
ID332058
Institutional Source Beutler Lab
Gene Symbol Olfr877
Ensembl Gene ENSMUSG00000066749
Gene Nameolfactory receptor 877
SynonymsGA_x6K02T2PVTD-31540342-31541277, MOR161-5
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37854269-37857320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37854905 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 29 (F29S)
Ref Sequence ENSEMBL: ENSMUSP00000150698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086063] [ENSMUST00000213956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086063
AA Change: F29S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083230
Gene: ENSMUSG00000066749
AA Change: F29S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-49 PFAM
Pfam:7tm_1 41 291 6.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213956
AA Change: F29S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Olfr877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr877 APN 9 37855181 missense probably damaging 1.00
IGL02108:Olfr877 APN 9 37854938 missense possibly damaging 0.88
IGL02474:Olfr877 APN 9 37855360 missense probably benign 0.08
R0006:Olfr877 UTSW 9 37855220 missense possibly damaging 0.95
R0893:Olfr877 UTSW 9 37855196 missense probably damaging 1.00
R1051:Olfr877 UTSW 9 37855361 missense probably damaging 0.99
R1432:Olfr877 UTSW 9 37855252 missense possibly damaging 0.79
R1718:Olfr877 UTSW 9 37855453 missense probably benign 0.03
R1864:Olfr877 UTSW 9 37855264 missense probably damaging 1.00
R4120:Olfr877 UTSW 9 37855409 missense possibly damaging 0.66
R4900:Olfr877 UTSW 9 37855312 missense probably benign
R5406:Olfr877 UTSW 9 37855219 missense probably benign 0.02
R6813:Olfr877 UTSW 9 37855514 missense possibly damaging 0.83
R7061:Olfr877 UTSW 9 37855646 missense possibly damaging 0.88
R7315:Olfr877 UTSW 9 37855247 missense probably benign
R7500:Olfr877 UTSW 9 37855018 missense probably damaging 1.00
R8021:Olfr877 UTSW 9 37855296 missense probably damaging 1.00
Z1088:Olfr877 UTSW 9 37855318 missense probably benign 0.31
Z1177:Olfr877 UTSW 9 37855498 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCTAGTTCCATAAGGTCCTCACC -3'
(R):5'- AACCCCACCAGCATTTTAGG -3'

Sequencing Primer
(F):5'- AGCGTTTGTAAGTGTCAGTAAACG -3'
(R):5'- ACCAGCATTTTAGGGGTGAG -3'
Posted On2015-07-21