Incidental Mutation 'R4507:Abr'
ID332063
Institutional Source Beutler Lab
Gene Symbol Abr
Ensembl Gene ENSMUSG00000017631
Gene Nameactive BCR-related gene
Synonyms6330400K15Rik
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.581) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76416734-76622314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76451857 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 608 (I608T)
Ref Sequence ENSEMBL: ENSMUSP00000091551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408]
Predicted Effect probably benign
Transcript: ENSMUST00000065028
AA Change: I378T

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631
AA Change: I378T

DomainStartEndE-ValueType
Pfam:RhoGEF 12 65 5.4e-11 PFAM
PH 84 243 1.58e-11 SMART
C2 287 394 1.88e-11 SMART
RhoGAP 440 619 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072740
AA Change: I596T

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631
AA Change: I596T

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094012
AA Change: I608T

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: I608T

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108407
AA Change: I550T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631
AA Change: I550T

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108408
AA Change: I559T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631
AA Change: I559T

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
RhoGEF 58 246 2.37e-56 SMART
PH 265 424 1.58e-11 SMART
C2 468 575 1.88e-11 SMART
RhoGAP 621 800 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130364
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Hoxc10 A T 15: 102,966,952 Y32F probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Abr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Abr APN 11 76423089 missense probably damaging 0.96
IGL00571:Abr APN 11 76468740 missense probably benign 0.45
IGL01774:Abr APN 11 76464299 splice site probably benign
IGL02208:Abr APN 11 76455645 missense probably damaging 1.00
IGL02477:Abr APN 11 76461360 missense probably damaging 1.00
IGL02499:Abr APN 11 76509090 missense probably benign 0.39
IGL02606:Abr APN 11 76479164 missense probably damaging 1.00
IGL02955:Abr APN 11 76419165 missense probably damaging 1.00
IGL03136:Abr APN 11 76425295 nonsense probably null
R0051:Abr UTSW 11 76472502 missense probably benign 0.02
R0311:Abr UTSW 11 76509127 missense possibly damaging 0.83
R0344:Abr UTSW 11 76479044 missense probably damaging 0.99
R0621:Abr UTSW 11 76509072 missense probably damaging 1.00
R0771:Abr UTSW 11 76455683 missense probably damaging 1.00
R1081:Abr UTSW 11 76455615 missense probably damaging 1.00
R1842:Abr UTSW 11 76508986 missense probably damaging 1.00
R2036:Abr UTSW 11 76452350 missense probably benign 0.08
R2147:Abr UTSW 11 76455648 missense probably damaging 1.00
R2250:Abr UTSW 11 76451939 missense probably damaging 1.00
R3153:Abr UTSW 11 76486469 missense probably damaging 1.00
R3928:Abr UTSW 11 76468735 missense probably benign 0.01
R4518:Abr UTSW 11 76472518 missense possibly damaging 0.72
R4632:Abr UTSW 11 76509019 missense probably benign 0.10
R4751:Abr UTSW 11 76456608 missense possibly damaging 0.79
R4853:Abr UTSW 11 76464261 missense probably damaging 1.00
R5255:Abr UTSW 11 76455683 missense probably damaging 1.00
R5693:Abr UTSW 11 76463577 missense probably damaging 1.00
R6459:Abr UTSW 11 76424989 missense probably damaging 0.98
R6478:Abr UTSW 11 76452332 missense probably damaging 0.99
R7030:Abr UTSW 11 76459212 missense probably damaging 1.00
R7221:Abr UTSW 11 76423161 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGGAACACGGTAGTCTACCTG -3'
(R):5'- TTGGAAAGCCACAAGTCTCCC -3'

Sequencing Primer
(F):5'- GGTAGTCTACCTGGGCCAG -3'
(R):5'- TCCCCTTCAGAAGCTCAGG -3'
Posted On2015-07-21