Incidental Mutation 'R0101:Filip1'
ID 33207
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms 5730485H21Rik
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock # R0101 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 79815051-80012851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79819528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 603 (I603T)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093811
AA Change: I603T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: I603T

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
B3galnt1 A G 3: 69,575,806 Y41H probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Cyp2d11 C A 15: 82,390,194 probably benign Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Fndc3b A G 3: 27,458,808 V723A probably damaging Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Itsn2 T C 12: 4,633,058 probably benign Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Spef2 T C 15: 9,713,108 T393A probably damaging Het
Srp54b A G 12: 55,255,620 probably benign Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79898260 missense probably benign 0.03
R9322:Filip1 UTSW 9 79819732 missense probably benign 0.01
R9334:Filip1 UTSW 9 79818457 missense probably benign 0.32
R9353:Filip1 UTSW 9 79818341 missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79819853 nonsense probably null
R9607:Filip1 UTSW 9 79819120 missense probably damaging 1.00
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGCTGGGAGAGGAAATTTGCC -3'
(R):5'- CCTCACGAAGCTGAAGTCCTTCAC -3'

Sequencing Primer
(F):5'- GAGAGGAAATTTGCCTTATCCTGC -3'
(R):5'- AGCTGAAGTCCTTCACTGTGATG -3'
Posted On 2013-05-09