Incidental Mutation 'R4507:Hoxc10'
ID332072
Institutional Source Beutler Lab
Gene Symbol Hoxc10
Ensembl Gene ENSMUSG00000022484
Gene Namehomeobox C10
SynonymsHox-3.6
MMRRC Submission 041756-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R4507 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102966796-102971893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102966952 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 32 (Y32F)
Ref Sequence ENSEMBL: ENSMUSP00000001699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001699]
Predicted Effect probably damaging
Transcript: ENSMUST00000001699
AA Change: Y32F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001699
Gene: ENSMUSG00000022484
AA Change: Y32F

DomainStartEndE-ValueType
low complexity region 143 157 N/A INTRINSIC
HOX 268 330 2.68e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The protein level is controlled during cell differentiation and proliferation, which may indicate this protein has a role in origin activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit skeletal transformations in thoracic, lumbar and sacral vertebrae, alterations in the pelvis and in the bones and ligaments of the hindlimb, femoral defects, decreased lumbar motor neuron and rib number, impairedcoordination, muscle wasting, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,145,872 Y83C probably damaging Het
Abca8a A T 11: 110,063,025 I863N probably benign Het
Abr A G 11: 76,451,857 I608T possibly damaging Het
Aebp1 A G 11: 5,870,565 Y485C probably damaging Het
Akap5 A G 12: 76,327,907 K38E possibly damaging Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Bmp3 A T 5: 98,879,774 I418L probably damaging Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Catsperb T A 12: 101,480,828 probably null Het
Clasrp C A 7: 19,585,240 probably benign Het
Clic1 A G 17: 35,052,785 T52A probably benign Het
Dnah7c C T 1: 46,766,611 R3407C probably damaging Het
Elp2 A G 18: 24,626,120 probably null Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Folh1 T C 7: 86,757,008 T286A probably benign Het
Gm8909 A T 17: 36,161,480 probably benign Het
Hcn2 T A 10: 79,724,786 I317N probably damaging Het
Hectd1 A T 12: 51,790,493 L760I probably damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Mdh1 C T 11: 21,558,470 V291M probably benign Het
Myh14 T C 7: 44,629,991 T963A probably benign Het
Mylk T C 16: 34,953,695 F1305L probably benign Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr877 T C 9: 37,854,905 F29S possibly damaging Het
Parp11 A G 6: 127,474,283 R99G probably damaging Het
Phactr1 C A 13: 43,096,794 T522N probably damaging Het
Ptprs T C 17: 56,419,014 T1423A probably damaging Het
Ralgapa2 T C 2: 146,353,248 I1253V probably benign Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Srrm4 T C 5: 116,446,553 Y486C probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tec T C 5: 72,760,358 D506G probably damaging Het
Trabd A G 15: 89,085,630 I316V probably damaging Het
Ubr5 A T 15: 38,013,542 F952I probably damaging Het
Vat1l T C 8: 114,205,816 L34P probably benign Het
Other mutations in Hoxc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Hoxc10 UTSW 15 102967482 missense probably benign 0.07
R1529:Hoxc10 UTSW 15 102967200 missense probably damaging 1.00
R1771:Hoxc10 UTSW 15 102967087 missense probably damaging 1.00
R2139:Hoxc10 UTSW 15 102967477 missense probably benign 0.19
R2962:Hoxc10 UTSW 15 102967300 missense probably damaging 1.00
R3849:Hoxc10 UTSW 15 102967444 missense probably benign 0.00
R3850:Hoxc10 UTSW 15 102967444 missense probably benign 0.00
R4650:Hoxc10 UTSW 15 102967263 missense probably benign 0.02
R5640:Hoxc10 UTSW 15 102967267 missense probably benign 0.39
R5951:Hoxc10 UTSW 15 102967318 missense possibly damaging 0.52
R6240:Hoxc10 UTSW 15 102970830 missense probably damaging 1.00
R6899:Hoxc10 UTSW 15 102967507 missense possibly damaging 0.83
R7110:Hoxc10 UTSW 15 102970921 missense probably damaging 1.00
R8012:Hoxc10 UTSW 15 102967467 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCGCGGATAATTATGGAGCTG -3'
(R):5'- TGCCAACAGGTTGTTCCAG -3'

Sequencing Primer
(F):5'- AATTATGGAGCTGATATTTCCCCC -3'
(R):5'- AACAGGTTGTTCCAGGCGGTAG -3'
Posted On2015-07-21