Incidental Mutation 'R2922:Gm20939'
ID332079
Institutional Source Beutler Lab
Gene Symbol Gm20939
Ensembl Gene ENSMUSG00000095193
Gene Namepredicted gene, 20939
Synonyms
MMRRC Submission 040507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2922 (G1)
Quality Score77
Status Validated
Chromosome17
Chromosomal Location94873986-94877497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94877293 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 456 (H456Q)
Ref Sequence ENSEMBL: ENSMUSP00000103642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108007]
Predicted Effect probably damaging
Transcript: ENSMUST00000108007
AA Change: H456Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103642
Gene: ENSMUSG00000095193
AA Change: H456Q

DomainStartEndE-ValueType
KRAB 3 65 7.59e-15 SMART
ZnF_C2H2 130 152 5.21e-4 SMART
ZnF_C2H2 158 180 1.18e-2 SMART
ZnF_C2H2 186 208 2.12e-4 SMART
ZnF_C2H2 214 236 2.57e-3 SMART
ZnF_C2H2 242 264 1.3e-4 SMART
ZnF_C2H2 270 292 2.99e-4 SMART
ZnF_C2H2 298 320 7.9e-4 SMART
ZnF_C2H2 326 348 1.6e-4 SMART
ZnF_C2H2 354 376 4.24e-4 SMART
ZnF_C2H2 382 404 2.79e-4 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 1.22e-4 SMART
ZnF_C2H2 466 488 4.17e-3 SMART
ZnF_C2H2 494 516 1.6e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Gm20939
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Gm20939 APN 17 94874293 splice site probably benign
R0015:Gm20939 UTSW 17 94876768 missense probably benign 0.00
R1563:Gm20939 UTSW 17 94877094 missense probably damaging 1.00
R1714:Gm20939 UTSW 17 94875806 missense probably damaging 1.00
R2029:Gm20939 UTSW 17 94875824 splice site probably benign
R2923:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3158:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3810:Gm20939 UTSW 17 94876710 missense possibly damaging 0.46
R4158:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R4304:Gm20939 UTSW 17 94877281 missense probably benign
R4307:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R5080:Gm20939 UTSW 17 94876991 missense probably damaging 1.00
R5271:Gm20939 UTSW 17 94877155 nonsense probably null
R5661:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R5771:Gm20939 UTSW 17 94874339 missense possibly damaging 0.93
R6800:Gm20939 UTSW 17 94877229 missense possibly damaging 0.75
R8393:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R8791:Gm20939 UTSW 17 94877220 missense probably damaging 1.00
Z1088:Gm20939 UTSW 17 94877433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGTAAAGTCTTTGGACGACAC -3'
(R):5'- TGGCTTTGTCACATTGGTTATATTCA -3'

Sequencing Primer
(F):5'- TTTGGACGACACAGTCATCTCAG -3'
(R):5'- CACAGAGTTACTCTTTAGTATGTGC -3'
Posted On2015-07-27