Incidental Mutation 'R0101:Pfkfb4'
ID 33208
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission 038387-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0101 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108820846-108861296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 108839711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 260 (P260R)
Ref Sequence ENSEMBL: ENSMUSP00000057197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
AlphaFold Q6DTY7
Predicted Effect probably benign
Transcript: ENSMUST00000051873
AA Change: P260R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: P260R

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably benign
Transcript: ENSMUST00000198140
AA Change: P276R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: P276R

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199184
Predicted Effect probably benign
Transcript: ENSMUST00000199591
AA Change: P276R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: P276R

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200229
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,901,739 (GRCm39) D829N probably benign Het
B3galnt1 A G 3: 69,483,139 (GRCm39) Y41H probably benign Het
Carmil3 A C 14: 55,735,212 (GRCm39) probably benign Het
Cdh17 A G 4: 11,771,341 (GRCm39) Q41R probably benign Het
Cep43 A T 17: 8,388,374 (GRCm39) S76C possibly damaging Het
Chrm2 G T 6: 36,501,430 (GRCm39) C429F probably damaging Het
Cplane1 T A 15: 8,250,444 (GRCm39) C1844S probably benign Het
Cyld T A 8: 89,444,928 (GRCm39) probably null Het
Cyp2d11 C A 15: 82,274,395 (GRCm39) probably benign Het
Dnah1 A G 14: 31,005,856 (GRCm39) Y2308H probably damaging Het
Dnajc27 T C 12: 4,139,142 (GRCm39) V60A probably benign Het
Dnmbp A G 19: 43,862,599 (GRCm39) V850A possibly damaging Het
Emcn A T 3: 137,047,001 (GRCm39) M1L possibly damaging Het
Epc1 A T 18: 6,462,998 (GRCm39) probably benign Het
Fbxo21 T C 5: 118,133,521 (GRCm39) L310P probably damaging Het
Filip1 A G 9: 79,726,810 (GRCm39) I603T probably benign Het
Fndc3b A G 3: 27,512,957 (GRCm39) V723A probably damaging Het
Gemin5 G A 11: 58,036,322 (GRCm39) P674S probably damaging Het
Gsk3a T C 7: 24,928,328 (GRCm39) D471G probably benign Het
Igbp1b G A 6: 138,634,658 (GRCm39) P262L probably damaging Het
Itga11 T C 9: 62,651,768 (GRCm39) L300S probably damaging Het
Itsn2 T C 12: 4,683,058 (GRCm39) probably benign Het
Lhcgr A G 17: 89,072,598 (GRCm39) S150P probably damaging Het
Man1a T C 10: 53,951,120 (GRCm39) M1V probably null Het
Mical2 C T 7: 111,936,074 (GRCm39) R892C possibly damaging Het
Mtus2 T C 5: 148,019,845 (GRCm39) S747P probably damaging Het
Mug1 A G 6: 121,861,206 (GRCm39) K1276E possibly damaging Het
Or1n1b A G 2: 36,780,138 (GRCm39) S241P probably damaging Het
Prkca A T 11: 107,948,626 (GRCm39) L121Q probably damaging Het
Prpf40b T C 15: 99,204,681 (GRCm39) probably benign Het
Ripor2 T C 13: 24,864,615 (GRCm39) M215T probably damaging Het
Rpn1 A G 6: 88,070,769 (GRCm39) D213G possibly damaging Het
Rreb1 C A 13: 38,115,518 (GRCm39) P959Q probably benign Het
Sema5b T C 16: 35,483,472 (GRCm39) probably benign Het
Slc38a10 A G 11: 120,041,903 (GRCm39) M1T probably null Het
Slco1c1 G T 6: 141,477,236 (GRCm39) L11F probably damaging Het
Spef2 T C 15: 9,713,194 (GRCm39) T393A probably damaging Het
Srp54b A G 12: 55,302,405 (GRCm39) probably benign Het
St14 G T 9: 31,008,403 (GRCm39) N512K probably benign Het
Syce1l T A 8: 114,382,061 (GRCm39) S237T probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tamm41 A T 6: 115,009,207 (GRCm39) Y129N probably damaging Het
Tctn2 T C 5: 124,753,357 (GRCm39) noncoding transcript Het
Tpr T C 1: 150,285,053 (GRCm39) probably benign Het
Vsig10 T A 5: 117,473,134 (GRCm39) probably null Het
Zfp335 T C 2: 164,741,910 (GRCm39) K635R probably damaging Het
Zfp541 A G 7: 15,811,968 (GRCm39) Y207C probably damaging Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108,828,202 (GRCm39) missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 108,858,010 (GRCm39) missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 108,859,404 (GRCm39) missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 108,836,364 (GRCm39) missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 108,836,769 (GRCm39) missense probably damaging 1.00
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 108,856,810 (GRCm39) splice site probably benign
R0511:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 108,856,688 (GRCm39) missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 108,836,373 (GRCm39) missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108,828,237 (GRCm39) missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 108,834,677 (GRCm39) missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 108,854,110 (GRCm39) splice site probably benign
R5470:Pfkfb4 UTSW 9 108,856,661 (GRCm39) missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 108,837,489 (GRCm39) missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 108,859,462 (GRCm39) unclassified probably benign
R6139:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 108,838,630 (GRCm39) splice site probably null
R6873:Pfkfb4 UTSW 9 108,839,403 (GRCm39) splice site probably null
R6958:Pfkfb4 UTSW 9 108,839,615 (GRCm39) missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 108,836,370 (GRCm39) missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 108,856,676 (GRCm39) missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 108,840,308 (GRCm39) missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108,828,019 (GRCm39) missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 108,854,179 (GRCm39) missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 108,834,667 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCTCTGGCAAGGGATCTGTCCTAC -3'
(R):5'- TCATGTGCGTTTGCTCAGCACC -3'

Sequencing Primer
(F):5'- AAGGGATCTGTCCTACATCAAG -3'
(R):5'- CGTTTGCTCAGCACCTCATC -3'
Posted On 2013-05-09