Incidental Mutation 'R2408:Dusp7'
ID332085
Institutional Source Beutler Lab
Gene Symbol Dusp7
Ensembl Gene ENSMUSG00000053716
Gene Namedual specificity phosphatase 7
SynonymsPYST2, MKP-X
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R2408 (G1)
Quality Score51
Status Validated
Chromosome9
Chromosomal Location106368632-106375724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106369162 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 122 (A122V)
Ref Sequence ENSEMBL: ENSMUSP00000126984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172306]
Predicted Effect probably benign
Transcript: ENSMUST00000172306
AA Change: A122V

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126984
Gene: ENSMUSG00000053716
AA Change: A122V

DomainStartEndE-ValueType
low complexity region 18 54 N/A INTRINSIC
RHOD 58 187 4.5e-11 SMART
low complexity region 195 213 N/A INTRINSIC
DSPc 247 387 8.53e-71 SMART
Blast:DSPc 393 416 8e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173051
Predicted Effect probably benign
Transcript: ENSMUST00000173748
SMART Domains Protein: ENSMUSP00000133511
Gene: ENSMUSG00000053716

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
DSPc 58 214 4.41e-64 SMART
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. DUSP7 belongs to a class of DUSPs, designated MKPs, that dephosphorylate MAPK (mitogen-activated protein kinase) proteins ERK (see MIM 601795), JNK (see MIM 601158), and p38 (see MIM 600289) with specificity distinct from that of individual MKP proteins. MKPs contain a highly conserved C-terminal catalytic domain and an N-terminal Cdc25 (see MIM 116947)-like (CH2) domain. MAPK activation cascades mediate various physiologic processes, including cellular proliferation, apoptosis, differentiation, and stress responses (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Dusp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03181:Dusp7 APN 9 106373810 missense probably damaging 1.00
alessi UTSW 9 106373741 missense probably damaging 1.00
R1118:Dusp7 UTSW 9 106373650 missense possibly damaging 0.91
R1952:Dusp7 UTSW 9 106370829 missense probably benign 0.05
R2049:Dusp7 UTSW 9 106373897 missense probably damaging 1.00
R3852:Dusp7 UTSW 9 106373893 missense probably benign 0.00
R4632:Dusp7 UTSW 9 106370766 missense possibly damaging 0.64
R5022:Dusp7 UTSW 9 106373741 missense probably damaging 1.00
R6273:Dusp7 UTSW 9 106373896 missense possibly damaging 0.57
R6525:Dusp7 UTSW 9 106369284 missense possibly damaging 0.91
R7161:Dusp7 UTSW 9 106368915 missense unknown
R7575:Dusp7 UTSW 9 106373677 missense probably damaging 1.00
R7818:Dusp7 UTSW 9 106369130 missense probably benign 0.28
R7856:Dusp7 UTSW 9 106368868 missense unknown
R8811:Dusp7 UTSW 9 106371042 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGGAGCCGCGGTTTAATTG -3'
(R):5'- TTCTGTCCTCACCTTGGAGG -3'

Sequencing Primer
(F):5'- GCGCACATGTCGACTTCG -3'
(R):5'- AGGTAGTAGGCCTGGCAGC -3'
Posted On2015-07-27