Incidental Mutation 'R2061:Dmbt1'
ID332091
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 040066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R2061 (G1)
Quality Score60
Status Validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 131099133 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 1014 (C1014G)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: C1177G
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: C1177G

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: C1188G
Predicted Effect possibly damaging
Transcript: ENSMUST00000213064
AA Change: C1014G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.6730 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,268,314 M395V probably benign Het
2610507B11Rik T A 11: 78,268,749 C541* probably null Het
9130011E15Rik C T 19: 45,978,667 R12Q probably damaging Het
A4gnt T C 9: 99,620,359 S191P probably damaging Het
AI314180 G T 4: 58,824,270 P1116T probably damaging Het
Ak2 C T 4: 129,008,197 A221V probably damaging Het
Akap9 T A 5: 3,961,010 V571E probably damaging Het
Amph G T 13: 19,125,035 E428* probably null Het
Arnt2 T A 7: 84,343,870 D154V probably damaging Het
Arrdc1 G A 2: 24,926,352 Q202* probably null Het
Ate1 A G 7: 130,510,913 C72R probably damaging Het
Atox1 A G 11: 55,454,898 V22A possibly damaging Het
Bbs12 A T 3: 37,319,066 M3L probably damaging Het
BC067074 T A 13: 113,318,094 W225R probably damaging Het
Bfsp1 A G 2: 143,862,678 V85A probably benign Het
Caskin2 C A 11: 115,803,630 V382F probably benign Het
Ccdc39 T A 3: 33,819,896 M596L probably damaging Het
Cd22 C T 7: 30,870,105 V529M probably damaging Het
Cd22 A C 7: 30,876,156 Y154D probably benign Het
Cdadc1 T A 14: 59,581,334 E348D probably damaging Het
Cdhr2 T C 13: 54,720,818 V531A probably damaging Het
Cdk11b A G 4: 155,641,604 probably benign Het
Cebpa G T 7: 35,119,522 R35L probably damaging Het
Chat T C 14: 32,446,873 N235S probably benign Het
Col12a1 T A 9: 79,617,705 I2725F possibly damaging Het
Cracr2b A G 7: 141,465,280 E231G probably damaging Het
Cryaa G T 17: 31,681,055 A151S probably benign Het
Dab1 A T 4: 104,678,741 I116F probably damaging Het
Ddx43 C A 9: 78,396,104 N75K probably benign Het
Dner C A 1: 84,405,989 C558F probably damaging Het
Dsc2 A G 18: 20,032,399 V839A possibly damaging Het
Dsg3 C T 18: 20,527,737 R378* probably null Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha6 T C 16: 59,655,797 M1069V probably damaging Het
F930017D23Rik A C 10: 43,604,420 noncoding transcript Het
Faf1 A T 4: 109,710,808 N22Y probably damaging Het
Flrt3 A T 2: 140,661,453 V85E probably damaging Het
Gadl1 T A 9: 115,941,380 I87N probably damaging Het
Galnt14 A G 17: 73,512,153 F314S probably damaging Het
Gba2 A T 4: 43,574,029 Y141* probably null Het
Gdap1 A T 1: 17,145,465 probably benign Het
Gfod1 A T 13: 43,303,243 probably null Het
Gm14295 C T 2: 176,810,681 R655* probably null Het
Gm4353 A G 7: 116,083,699 S216P probably damaging Het
Gm6605 T A 7: 38,448,282 noncoding transcript Het
Hectd1 A T 12: 51,794,444 D634E probably damaging Het
Helz2 A G 2: 181,240,544 I152T probably damaging Het
Hivep1 A G 13: 42,160,124 K1947E possibly damaging Het
Ifrd1 A T 12: 40,213,245 F144L probably benign Het
Itgae A T 11: 73,118,622 Q544L probably benign Het
Jmjd1c A T 10: 67,218,426 E323D probably damaging Het
Kdm5a G T 6: 120,381,617 R207L probably benign Het
Kif5b C T 18: 6,226,377 probably null Het
Lbp T C 2: 158,324,579 V351A probably benign Het
Lss A T 10: 76,546,098 probably null Het
Madd A C 2: 91,161,486 probably benign Het
Map6 G A 7: 99,317,472 V503I probably damaging Het
Mark1 A G 1: 184,928,063 L22P probably damaging Het
Mcfd2 T C 17: 87,255,976 N130D probably damaging Het
Mcm3ap A G 10: 76,470,068 N5S probably benign Het
Mdm4 A T 1: 133,012,651 F48I probably damaging Het
Mga A T 2: 119,964,980 probably benign Het
Mknk2 A T 10: 80,671,557 probably null Het
Mmp15 T C 8: 95,370,779 Y459H possibly damaging Het
Mthfd1l A G 10: 4,103,288 K879R probably benign Het
Mycbp2 T C 14: 103,287,260 K655E probably damaging Het
Nasp T C 4: 116,611,126 N221D probably benign Het
Ndc80 T C 17: 71,514,218 E245G probably benign Het
Nmral1 C T 16: 4,716,329 E83K probably damaging Het
Noa1 T A 5: 77,304,187 Q550L possibly damaging Het
Nutm1 A T 2: 112,255,752 Y211* probably null Het
Olfr1420 T A 19: 11,896,557 Y179N probably damaging Het
Olfr1474 A G 19: 13,471,241 I90M probably damaging Het
Olfr148 G T 9: 39,613,775 M69I probably benign Het
Olfr700 A C 7: 106,805,768 H231Q probably benign Het
Olfr723 T C 14: 49,929,021 I174M possibly damaging Het
Otoa T C 7: 121,131,328 F584L probably damaging Het
Palb2 G A 7: 122,124,525 T304I possibly damaging Het
Pcolce2 A T 9: 95,670,176 M121L probably benign Het
Pcsk5 T C 19: 17,454,872 T1460A probably benign Het
Pdzrn4 A T 15: 92,770,160 D731V probably damaging Het
Pex11b C A 3: 96,635,721 Q12K possibly damaging Het
Pigw G C 11: 84,877,310 Q398E probably benign Het
Pkd1 A G 17: 24,569,914 E882G possibly damaging Het
Pkhd1 A T 1: 20,612,812 N55K possibly damaging Het
Plch2 A T 4: 155,042,841 probably benign Het
Plcl1 T A 1: 55,751,345 L1058Q probably benign Het
Ppfia2 T C 10: 106,837,329 S511P possibly damaging Het
Ppfibp2 T C 7: 107,739,230 L676P probably damaging Het
Ppp6c T G 2: 39,226,174 D23A probably damaging Het
Pqlc1 G T 18: 80,291,715 A232S probably benign Het
Prss30 G A 17: 23,974,668 probably benign Het
Ptprz1 T C 6: 23,049,675 probably null Het
Rec114 T A 9: 58,652,905 probably benign Het
Ryr2 T C 13: 11,665,878 probably null Het
Ryr3 A T 2: 112,663,004 I3715N possibly damaging Het
Scin T C 12: 40,080,948 Y322C probably damaging Het
Scn3a A G 2: 65,461,308 V1698A probably damaging Het
Scn5a G A 9: 119,485,651 S1996L probably damaging Het
Serpinb2 A G 1: 107,522,795 K174R possibly damaging Het
Slc16a4 T C 3: 107,300,711 I179T probably benign Het
Slc35b1 T G 11: 95,385,892 F102V possibly damaging Het
Slc6a15 A G 10: 103,409,734 D526G probably benign Het
Spata16 A G 3: 26,924,370 D495G probably damaging Het
Stk11ip G A 1: 75,529,584 E583K possibly damaging Het
Stk-ps1 T G 17: 36,398,152 noncoding transcript Het
Sufu T A 19: 46,397,212 I37N probably damaging Het
Tacr1 C T 6: 82,492,554 P140S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tenm3 C T 8: 48,342,256 probably null Het
Tex36 A T 7: 133,595,223 I55N probably damaging Het
Tmem150c T C 5: 100,080,028 Y192C probably damaging Het
Tmem237 A G 1: 59,120,286 probably benign Het
Trim11 A G 11: 58,982,063 E191G probably damaging Het
Ttll3 C T 6: 113,409,042 A612V possibly damaging Het
Ttn G A 2: 76,977,122 A89V probably damaging Het
Usp37 A G 1: 74,468,272 F529L probably damaging Het
Vmn1r217 A C 13: 23,114,528 V68G probably benign Het
Vwf T C 6: 125,591,188 S349P probably damaging Het
Wt1 G A 2: 105,131,157 probably null Het
Zcchc7 T A 4: 44,895,838 L262H probably damaging Het
Zfp873 A G 10: 82,060,157 S241G probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7584:Dmbt1 UTSW 7 131088751 nonsense probably null
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTTTACAAGGGATGCTGGGC -3'
(R):5'- ATGGACATTCATTCTCACAAGGG -3'

Sequencing Primer
(F):5'- GCATGGGAAGATAGATGAATTACC -3'
(R):5'- AGGGAACTTACTTGTGCTGAC -3'
Posted On2015-07-30