Incidental Mutation 'R2926:Ppp1cc'
ID332100
Institutional Source Beutler Lab
Gene Symbol Ppp1cc
Ensembl Gene ENSMUSG00000004455
Gene Nameprotein phosphatase 1, catalytic subunit, gamma isoform
SynonymsPP1C gamma, PP1C gamma 2, PP1C gamma 1, PP1
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2926 (G1)
Quality Score52
Status Validated
Chromosome5
Chromosomal Location122158278-122175273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122174088 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 306 (A306T)
Ref Sequence ENSEMBL: ENSMUSP00000099587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086294] [ENSMUST00000102528] [ENSMUST00000128309] [ENSMUST00000132555]
Predicted Effect probably benign
Transcript: ENSMUST00000086294
AA Change: A306T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083474
Gene: ENSMUSG00000004455
AA Change: A306T

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102528
AA Change: A306T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099587
Gene: ENSMUSG00000004455
AA Change: A306T

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128309
SMART Domains Protein: ENSMUSP00000142415
Gene: ENSMUSG00000004455

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132555
SMART Domains Protein: ENSMUSP00000143509
Gene: ENSMUSG00000004455

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133568
Predicted Effect probably benign
Transcript: ENSMUST00000134719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142562
Predicted Effect probably benign
Transcript: ENSMUST00000151184
Predicted Effect
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to severely impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Ppp1cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02747:Ppp1cc APN 5 122174073 missense probably benign 0.02
R0524:Ppp1cc UTSW 5 122172770 nonsense probably null
R1223:Ppp1cc UTSW 5 122168214 missense probably damaging 1.00
R2999:Ppp1cc UTSW 5 122174088 missense probably benign
R4133:Ppp1cc UTSW 5 122168226 missense probably benign 0.08
R8031:Ppp1cc UTSW 5 122174088 missense probably benign
Z1088:Ppp1cc UTSW 5 122172753 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGGCACTTCTCCACCAAAATG -3'
(R):5'- AGCAAGTGCCAGCAGTAATC -3'

Sequencing Primer
(F):5'- AATGCTCAGGGACCAGTCG -3'
(R):5'- CAAGTGCCAGCAGTAATCAAATG -3'
Posted On2015-08-05