Incidental Mutation 'R0101:Itsn2'
ID33214
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0101 (G1)
Quality Score191
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 4633058 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000218402] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect unknown
Transcript: ENSMUST00000062580
AA Change: V328A
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: V328A

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect probably benign
Transcript: ENSMUST00000218402
Predicted Effect unknown
Transcript: ENSMUST00000219007
AA Change: V328A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect unknown
Transcript: ENSMUST00000220311
AA Change: V328A
Meta Mutation Damage Score 0.2936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
B3galnt1 A G 3: 69,575,806 Y41H probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Cyp2d11 C A 15: 82,390,194 probably benign Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Filip1 A G 9: 79,819,528 I603T probably benign Het
Fndc3b A G 3: 27,458,808 V723A probably damaging Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Spef2 T C 15: 9,713,108 T393A probably damaging Het
Srp54b A G 12: 55,255,620 probably benign Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
Liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
Stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTGTGAACGGTCACATTGCC -3'
(R):5'- TGTTAACCAGAGACCCAGACTCAGC -3'

Sequencing Primer
(F):5'- GAACGGTCACATTGCCTTTAG -3'
(R):5'- actcagctaactgctgttcc -3'
Posted On2013-05-09