Mutagenetix > Incidental Mutations

Incidental Mutation 'R0101:Itsn2'

33214

Institutional Source

Beutler Lab

Gene Symbol

Itsn2

Ensembl Gene

ENSMUSG00000020640

Gene Name

intersectin 2

Synonyms

Sh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18

MMRRC Submission

038387-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0101 (G1)

Quality Score

191

Status

Validated

Chromosome

Chromosomal Location

4592638-4713962 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 4633058 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000218402] [ENSMUST00000219007] [ENSMUST00000220311]

Predicted Effect

unknown
Transcript: ENSMUST00000062580
AA Change: V328A

SMART Domains

Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: V328A

Domain	Start	End	E-Value	Type
EH	15	109	8.44e-41	SMART
EFh	58	86	7.18e-3	SMART
low complexity region	156	169	N/A	INTRINSIC
low complexity region	215	231	N/A	INTRINSIC
EH	238	333	4.06e-43	SMART
EFh	282	310	6.16e-2	SMART
coiled coil region	366	462	N/A	INTRINSIC
coiled coil region	516	556	N/A	INTRINSIC
coiled coil region	580	715	N/A	INTRINSIC
SH3	721	778	2.65e-21	SMART
low complexity region	791	811	N/A	INTRINSIC
SH3	855	909	8.83e-18	SMART
SH3	945	999	9.1e-20	SMART
SH3	1017	1077	1.55e-13	SMART
SH3	1091	1146	7.22e-23	SMART
RhoGEF	1174	1355	1.93e-56	SMART
PH	1396	1507	1.16e-9	SMART
C2	1531	1628	3.96e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217981

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218072

Predicted Effect

probably benign
Transcript: ENSMUST00000218402

Predicted Effect

unknown
Transcript: ENSMUST00000219007
AA Change: V328A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219832

Predicted Effect

unknown
Transcript: ENSMUST00000220311
AA Change: V328A

Meta Mutation Damage Score

0.2936

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,220,960	C1844S	probably benign	Het
Aatk	C	T	11: 120,010,913	D829N	probably benign	Het
B3galnt1	A	G	3: 69,575,806	Y41H	probably benign	Het
Carmil3	A	C	14: 55,497,755		probably benign	Het
Cdh17	A	G	4: 11,771,341	Q41R	probably benign	Het
Chrm2	G	T	6: 36,524,495	C429F	probably damaging	Het
Cyld	T	A	8: 88,718,300		probably null	Het
Cyp2d11	C	A	15: 82,390,194		probably benign	Het
Dnah1	A	G	14: 31,283,899	Y2308H	probably damaging	Het
Dnajc27	T	C	12: 4,089,142	V60A	probably benign	Het
Dnmbp	A	G	19: 43,874,160	V850A	possibly damaging	Het
Emcn	A	T	3: 137,341,240	M1L	possibly damaging	Het
Epc1	A	T	18: 6,462,998		probably benign	Het
Fbxo21	T	C	5: 117,995,456	L310P	probably damaging	Het
Fgfr1op	A	T	17: 8,169,542	S76C	possibly damaging	Het
Filip1	A	G	9: 79,819,528	I603T	probably benign	Het
Fndc3b	A	G	3: 27,458,808	V723A	probably damaging	Het
Gemin5	G	A	11: 58,145,496	P674S	probably damaging	Het
Gsk3a	T	C	7: 25,228,903	D471G	probably benign	Het
Igbp1b	G	A	6: 138,657,660	P262L	probably damaging	Het
Itga11	T	C	9: 62,744,486	L300S	probably damaging	Het
Lhcgr	A	G	17: 88,765,170	S150P	probably damaging	Het
Man1a	T	C	10: 54,075,024	M1V	probably null	Het
Mical2	C	T	7: 112,336,867	R892C	possibly damaging	Het
Mtus2	T	C	5: 148,083,035	S747P	probably damaging	Het
Mug1	A	G	6: 121,884,247	K1276E	possibly damaging	Het
Olfr353	A	G	2: 36,890,126	S241P	probably damaging	Het
Pfkfb4	C	G	9: 109,010,643	P260R	probably benign	Het
Prkca	A	T	11: 108,057,800	L121Q	probably damaging	Het
Prpf40b	T	C	15: 99,306,800		probably benign	Het
Ripor2	T	C	13: 24,680,632	M215T	probably damaging	Het
Rpn1	A	G	6: 88,093,787	D213G	possibly damaging	Het
Rreb1	C	A	13: 37,931,542	P959Q	probably benign	Het
Sema5b	T	C	16: 35,663,102		probably benign	Het
Slc38a10	A	G	11: 120,151,077	M1T	probably null	Het
Slco1c1	G	T	6: 141,531,510	L11F	probably damaging	Het
Spef2	T	C	15: 9,713,108	T393A	probably damaging	Het
Srp54b	A	G	12: 55,255,620		probably benign	Het
St14	G	T	9: 31,097,107	N512K	probably benign	Het
Syce1l	T	A	8: 113,655,429	S237T	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tamm41	A	T	6: 115,032,246	Y129N	probably damaging	Het
Tctn2	T	C	5: 124,615,294		noncoding transcript	Het
Tpr	T	C	1: 150,409,302		probably benign	Het
Vsig10	T	A	5: 117,335,069		probably null	Het
Zfp335	T	C	2: 164,899,990	K635R	probably damaging	Het
Zfp541	A	G	7: 16,078,043	Y207C	probably damaging	Het

Other mutations in Itsn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Itsn2	APN	12	4658027	missense	possibly damaging	0.95
IGL00647:Itsn2	APN	12	4613311	splice site	probably benign
IGL00933:Itsn2	APN	12	4707540	missense	probably damaging	1.00
IGL01686:Itsn2	APN	12	4636693	splice site	probably benign
IGL01873:Itsn2	APN	12	4632366	splice site	probably benign
IGL02200:Itsn2	APN	12	4636632	missense	probably damaging	0.98
IGL02280:Itsn2	APN	12	4708961	missense	possibly damaging	0.89
IGL02388:Itsn2	APN	12	4629557	missense	possibly damaging	0.91
IGL02938:Itsn2	APN	12	4697216	missense	probably damaging	0.98
inversus	UTSW	12	4639670	nonsense	probably null
Liberator	UTSW	12	4666176	nonsense	probably null
rolled	UTSW	12	4634792	nonsense	probably null
Stratofortress	UTSW	12	4624927	missense	probably damaging	1.00
R0268:Itsn2	UTSW	12	4700333	missense	probably benign	0.12
R0584:Itsn2	UTSW	12	4697180	missense	probably benign
R0604:Itsn2	UTSW	12	4658189	missense	probably benign	0.01
R0639:Itsn2	UTSW	12	4712556	missense	probably damaging	0.99
R0738:Itsn2	UTSW	12	4635681	missense	probably benign	0.17
R1132:Itsn2	UTSW	12	4658464	missense	probably damaging	1.00
R1163:Itsn2	UTSW	12	4712009	missense	probably benign	0.30
R1169:Itsn2	UTSW	12	4639694	missense	probably damaging	1.00
R1258:Itsn2	UTSW	12	4673464	missense	probably damaging	1.00
R1297:Itsn2	UTSW	12	4700378	missense	probably damaging	1.00
R1423:Itsn2	UTSW	12	4673572	missense	probably damaging	0.97
R1572:Itsn2	UTSW	12	4650044	missense	probably benign	0.03
R1601:Itsn2	UTSW	12	4658452	missense	probably benign	0.01
R1628:Itsn2	UTSW	12	4629652	missense	probably benign
R1650:Itsn2	UTSW	12	4637767	missense	probably damaging	0.97
R1752:Itsn2	UTSW	12	4711950	splice site	probably null
R1758:Itsn2	UTSW	12	4658160	missense	possibly damaging	0.83
R1942:Itsn2	UTSW	12	4639670	nonsense	probably null
R1976:Itsn2	UTSW	12	4672733	splice site	probably benign
R2000:Itsn2	UTSW	12	4666176	nonsense	probably null
R2060:Itsn2	UTSW	12	4627879	missense	probably damaging	1.00
R2119:Itsn2	UTSW	12	4707025	missense	probably benign	0.32
R2168:Itsn2	UTSW	12	4633044	unclassified	probably benign
R2394:Itsn2	UTSW	12	4707005	missense	possibly damaging	0.86
R2860:Itsn2	UTSW	12	4700315	splice site	probably benign
R2861:Itsn2	UTSW	12	4700315	splice site	probably benign
R2900:Itsn2	UTSW	12	4630713	unclassified	probably benign
R2991:Itsn2	UTSW	12	4658474	missense	probably benign	0.01
R3087:Itsn2	UTSW	12	4666303	missense	probably damaging	1.00
R3881:Itsn2	UTSW	12	4634546	unclassified	probably benign
R4022:Itsn2	UTSW	12	4624927	missense	probably damaging	1.00
R4332:Itsn2	UTSW	12	4712611	missense	possibly damaging	0.72
R4657:Itsn2	UTSW	12	4713197	makesense	probably null
R4727:Itsn2	UTSW	12	4707660	missense	probably damaging	0.99
R4745:Itsn2	UTSW	12	4661944	missense	probably damaging	1.00
R4770:Itsn2	UTSW	12	4627892	missense	probably damaging	1.00
R4905:Itsn2	UTSW	12	4634583	unclassified	probably benign
R5269:Itsn2	UTSW	12	4633553	unclassified	probably benign
R5314:Itsn2	UTSW	12	4627960	missense	probably benign	0.09
R5345:Itsn2	UTSW	12	4672783	missense	probably damaging	1.00
R5399:Itsn2	UTSW	12	4653535	missense	probably benign	0.22
R5566:Itsn2	UTSW	12	4626554	missense	probably damaging	1.00
R5725:Itsn2	UTSW	12	4630767	unclassified	probably benign
R5773:Itsn2	UTSW	12	4707089	missense	probably damaging	1.00
R6116:Itsn2	UTSW	12	4629939	unclassified	probably benign
R6254:Itsn2	UTSW	12	4624982	splice site	probably null
R6325:Itsn2	UTSW	12	4706351	missense	probably damaging	1.00
R6361:Itsn2	UTSW	12	4629655	missense	probably benign	0.18
R6456:Itsn2	UTSW	12	4629923	unclassified	probably benign
R6494:Itsn2	UTSW	12	4634792	nonsense	probably null
R6854:Itsn2	UTSW	12	4652382	missense	probably benign	0.37
R6941:Itsn2	UTSW	12	4629641	missense	probably benign	0.05
R6961:Itsn2	UTSW	12	4673420	nonsense	probably null
R7326:Itsn2	UTSW	12	4632985	missense	unknown
R7387:Itsn2	UTSW	12	4639781	missense	probably damaging	1.00
R7465:Itsn2	UTSW	12	4706983	nonsense	probably null
R7471:Itsn2	UTSW	12	4708198	missense	probably benign	0.43
Z1088:Itsn2	UTSW	12	4712472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTTGTGAACGGTCACATTGCC -3'
(R):5'- TGTTAACCAGAGACCCAGACTCAGC -3'

Sequencing Primer
(F):5'- GAACGGTCACATTGCCTTTAG -3'
(R):5'- actcagctaactgctgttcc -3'

Posted On

2013-05-09