Incidental Mutation 'R0101:Spef2'
ID33220
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0101 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9713108 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 393 (T393A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041840
AA Change: T393A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: T393A

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159093
AA Change: T450A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: T450A

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159288
AA Change: T393A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: T393A

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159368
AA Change: T393A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: T393A

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160236
AA Change: T393A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: T393A

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162780
AA Change: T450A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: T450A

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: T393A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
B3galnt1 A G 3: 69,575,806 Y41H probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Cyp2d11 C A 15: 82,390,194 probably benign Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Filip1 A G 9: 79,819,528 I603T probably benign Het
Fndc3b A G 3: 27,458,808 V723A probably damaging Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Itsn2 T C 12: 4,633,058 probably benign Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Srp54b A G 12: 55,255,620 probably benign Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 synonymous probably null
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATTGTGTCTGCTCTGCCTATCAA -3'
(R):5'- GCCATCTGACCCGGACTAACGTATTT -3'

Sequencing Primer
(F):5'- GCTCTGCCTATCAATTGTGTG -3'
(R):5'- GCTGTCATACGCAATACTTAGAG -3'
Posted On2013-05-09