Incidental Mutation 'R0101:Cyp2d11'
ID33221
Institutional Source Beutler Lab
Gene Symbol Cyp2d11
Ensembl Gene ENSMUSG00000068085
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 11
SynonymsCyp2d, P450-2D
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0101 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82389154-82394022 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 82390194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170255]
Predicted Effect probably benign
Transcript: ENSMUST00000170255
SMART Domains Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 7.7e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183858
Meta Mutation Damage Score 0.0901 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
B3galnt1 A G 3: 69,575,806 Y41H probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Filip1 A G 9: 79,819,528 I603T probably benign Het
Fndc3b A G 3: 27,458,808 V723A probably damaging Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Itsn2 T C 12: 4,633,058 probably benign Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Spef2 T C 15: 9,713,108 T393A probably damaging Het
Srp54b A G 12: 55,255,620 probably benign Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in Cyp2d11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cyp2d11 APN 15 82392468 missense probably benign 0.00
IGL00896:Cyp2d11 APN 15 82391074 splice site probably benign
IGL02119:Cyp2d11 APN 15 82390064 missense probably damaging 0.98
IGL02234:Cyp2d11 APN 15 82390139 missense probably benign
IGL02347:Cyp2d11 APN 15 82390480 missense probably benign 0.22
IGL02352:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02359:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02876:Cyp2d11 APN 15 82389496 missense possibly damaging 0.85
IGL03079:Cyp2d11 APN 15 82390966 missense probably damaging 1.00
IGL03259:Cyp2d11 APN 15 82390020 missense probably damaging 0.99
FR4340:Cyp2d11 UTSW 15 82390022 frame shift probably null
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0125:Cyp2d11 UTSW 15 82389221 missense probably benign 0.45
R0973:Cyp2d11 UTSW 15 82389529 missense possibly damaging 0.80
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1525:Cyp2d11 UTSW 15 82389297 missense probably damaging 0.98
R1708:Cyp2d11 UTSW 15 82390432 missense probably benign 0.01
R1968:Cyp2d11 UTSW 15 82389548 missense probably benign 0.01
R2117:Cyp2d11 UTSW 15 82391753 missense probably damaging 0.99
R2223:Cyp2d11 UTSW 15 82390131 missense probably benign 0.23
R2405:Cyp2d11 UTSW 15 82389266 missense possibly damaging 0.88
R3745:Cyp2d11 UTSW 15 82391855 missense probably benign 0.31
R4081:Cyp2d11 UTSW 15 82391801 missense possibly damaging 0.86
R4496:Cyp2d11 UTSW 15 82391948 splice site probably benign
R4732:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4733:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4880:Cyp2d11 UTSW 15 82392105 missense probably benign 0.01
R4898:Cyp2d11 UTSW 15 82391023 missense probably benign 0.03
R5045:Cyp2d11 UTSW 15 82391071 critical splice acceptor site probably null
R5328:Cyp2d11 UTSW 15 82391771 missense probably benign 0.04
R5356:Cyp2d11 UTSW 15 82390511 missense probably benign 0.11
R5397:Cyp2d11 UTSW 15 82392078 missense probably damaging 1.00
R5582:Cyp2d11 UTSW 15 82392118 splice site probably null
R6862:Cyp2d11 UTSW 15 82390138 missense probably benign
R7194:Cyp2d11 UTSW 15 82391768 missense probably benign
R8097:Cyp2d11 UTSW 15 82390380 critical splice donor site probably null
R8122:Cyp2d11 UTSW 15 82392543 missense probably benign 0.27
R8152:Cyp2d11 UTSW 15 82392487 missense probably benign
R8194:Cyp2d11 UTSW 15 82390437 missense probably damaging 1.00
R8531:Cyp2d11 UTSW 15 82389228 missense probably benign
Z1088:Cyp2d11 UTSW 15 82390111 missense probably damaging 0.99
Z1177:Cyp2d11 UTSW 15 82392499 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTTGTGATGCGTGGCAAAGG -3'
(R):5'- GGGAATCCTGAGAGCAGCTTCAATG -3'

Sequencing Primer
(F):5'- GCAGTGGAGCAATGTCCC -3'
(R):5'- GCTTCAATGATGAGAACCTGC -3'
Posted On2013-05-09