Incidental Mutation 'R0105:Cr1l'
Institutional Source Beutler Lab
Gene Symbol Cr1l
Ensembl Gene ENSMUSG00000016481
Gene Namecomplement component (3b/4b) receptor 1-like
SynonymsmCRY, Crry
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0105 (G1)
Quality Score205
Status Validated (trace)
Chromosomal Location195097382-195131586 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 195112412 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075451] [ENSMUST00000191775] [ENSMUST00000193094] [ENSMUST00000194062] [ENSMUST00000194111]
Predicted Effect probably benign
Transcript: ENSMUST00000075451
SMART Domains Protein: ENSMUSP00000074902
Gene: ENSMUSG00000016481

low complexity region 27 39 N/A INTRINSIC
CCP 42 98 3.51e-6 SMART
CCP 103 160 1.61e-14 SMART
CCP 165 231 7.92e-14 SMART
CCP 237 293 5.23e-14 SMART
CCP 299 355 6.69e-12 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191775
SMART Domains Protein: ENSMUSP00000141250
Gene: ENSMUSG00000016481

Pfam:Sushi 1 38 9e-6 PFAM
CCP 43 100 8e-17 SMART
CCP 105 171 3.9e-16 SMART
CCP 177 233 2.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193094
SMART Domains Protein: ENSMUSP00000142309
Gene: ENSMUSG00000016481

signal peptide 1 40 N/A INTRINSIC
CCP 42 98 1.7e-8 SMART
CCP 103 160 8e-17 SMART
CCP 165 231 3.9e-16 SMART
CCP 237 293 2.6e-16 SMART
CCP 299 355 3.3e-14 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194062
SMART Domains Protein: ENSMUSP00000142104
Gene: ENSMUSG00000016481

CCP 1 52 2.9e-9 SMART
CCP 58 114 3.3e-14 SMART
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194111
SMART Domains Protein: ENSMUSP00000142069
Gene: ENSMUSG00000016481

CCP 4 60 1.7e-8 SMART
CCP 65 122 8e-17 SMART
CCP 127 193 3.9e-16 SMART
CCP 199 255 2.6e-16 SMART
CCP 261 317 3.3e-14 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195586
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die by E16.5 with abnormal C3 deposition. Mice homozygous for a null allele activated in single positive thymocytes exhibit T cell lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Cr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cr1l APN 1 195129881 missense possibly damaging 0.86
IGL01988:Cr1l APN 1 195117550 missense probably damaging 1.00
IGL02412:Cr1l APN 1 195114772 missense probably damaging 0.97
IGL02412:Cr1l APN 1 195114766 missense probably damaging 1.00
IGL02707:Cr1l APN 1 195123711 missense probably benign 0.03
IGL02726:Cr1l APN 1 195129880 missense probably damaging 1.00
R0153:Cr1l UTSW 1 195114856 splice site probably benign
R0302:Cr1l UTSW 1 195117793 missense probably damaging 0.99
R1444:Cr1l UTSW 1 195131202 missense probably damaging 0.99
R1760:Cr1l UTSW 1 195114815 missense probably benign 0.01
R2402:Cr1l UTSW 1 195106902 missense probably benign 0.04
R4583:Cr1l UTSW 1 195129831 missense probably damaging 0.97
R5977:Cr1l UTSW 1 195114768 nonsense probably null
R6113:Cr1l UTSW 1 195131411 unclassified probably benign
R6324:Cr1l UTSW 1 195111122 missense probably benign 0.07
R6424:Cr1l UTSW 1 195117815 missense probably damaging 1.00
R7082:Cr1l UTSW 1 195123698 missense probably benign 0.36
R7174:Cr1l UTSW 1 195129189 missense probably benign 0.00
R7199:Cr1l UTSW 1 195117570 missense probably benign 0.20
R7979:Cr1l UTSW 1 195117722 missense probably damaging 1.00
R8104:Cr1l UTSW 1 195117617 missense possibly damaging 0.80
X0020:Cr1l UTSW 1 195129853 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtccatcagcccccaag -3'
(R):5'- gaacaaacaaagaaacaaagaacaag -3'
Posted On2013-05-09