Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Pla2r1'

33237

Institutional Source

Beutler Lab

Gene Symbol

Pla2r1

Ensembl Gene

ENSMUSG00000054580

Gene Name

phospholipase A2 receptor 1

Synonyms

M-type receptor, Pla2g1br, PLA2-I receptor

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0105 (G1)

Quality Score

201

Status

Validated (trace)

Chromosome

Chromosomal Location

60417543-60553308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60514981 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 344 (R344G)

Ref Sequence

ENSEMBL: ENSMUSP00000108144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112525]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112525
AA Change: R344G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: R344G

Domain	Start	End	E-Value	Type
low complexity region	35	62	N/A	INTRINSIC
RICIN	77	189	2.98e-16	SMART
FN2	209	257	1.17e-25	SMART
CLECT	267	392	7.66e-30	SMART
CLECT	415	539	1.88e-29	SMART
CLECT	552	679	5.42e-21	SMART
CLECT	699	832	3.58e-21	SMART
CLECT	847	973	7.55e-20	SMART
CLECT	992	1131	5.05e-30	SMART
CLECT	1148	1267	4.72e-21	SMART
CLECT	1281	1412	1.44e-25	SMART
transmembrane domain	1432	1454	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128208

Meta Mutation Damage Score

0.0964

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Pla2r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Pla2r1	APN	2	60420425	missense	probably benign
IGL00886:Pla2r1	APN	2	60424324	missense	probably damaging	1.00
IGL00928:Pla2r1	APN	2	60535080	missense	probably damaging	0.99
IGL01361:Pla2r1	APN	2	60479470	missense	probably damaging	1.00
IGL01403:Pla2r1	APN	2	60424288	missense	probably damaging	0.99
IGL01475:Pla2r1	APN	2	60441081	splice site	probably benign
IGL01517:Pla2r1	APN	2	60504253	missense	probably damaging	1.00
IGL01646:Pla2r1	APN	2	60495364	missense	probably damaging	1.00
IGL02208:Pla2r1	APN	2	60428588	missense	possibly damaging	0.81
IGL02301:Pla2r1	APN	2	60452436	missense	probably benign	0.01
IGL02522:Pla2r1	APN	2	60428669	missense	probably benign	0.11
IGL02688:Pla2r1	APN	2	60455201	missense	probably damaging	1.00
IGL02822:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02850:Pla2r1	APN	2	60502069	missense	probably benign	0.03
IGL03233:Pla2r1	APN	2	60428580	missense	possibly damaging	0.63
IGL03350:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02980:Pla2r1	UTSW	2	60515046	missense	possibly damaging	0.77
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0387:Pla2r1	UTSW	2	60432601	missense	probably benign	0.03
R0522:Pla2r1	UTSW	2	60479515	missense	probably benign	0.01
R0550:Pla2r1	UTSW	2	60425350	critical splice donor site	probably null
R0718:Pla2r1	UTSW	2	60479530	missense	possibly damaging	0.55
R0906:Pla2r1	UTSW	2	60514947	missense	possibly damaging	0.79
R0945:Pla2r1	UTSW	2	60458410	missense	possibly damaging	0.89
R1229:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1397:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1667:Pla2r1	UTSW	2	60420257	missense	probably benign	0.00
R1668:Pla2r1	UTSW	2	60428646	missense	probably damaging	0.99
R1694:Pla2r1	UTSW	2	60441084	critical splice donor site	probably null
R1864:Pla2r1	UTSW	2	60428711	missense	probably benign	0.01
R2029:Pla2r1	UTSW	2	60431973	missense	probably damaging	0.99
R2035:Pla2r1	UTSW	2	60422736	missense	probably damaging	1.00
R2207:Pla2r1	UTSW	2	60458435	missense	probably damaging	1.00
R2429:Pla2r1	UTSW	2	60514968	missense	probably damaging	1.00
R3196:Pla2r1	UTSW	2	60522783	missense	probably damaging	1.00
R3522:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R3973:Pla2r1	UTSW	2	60448962	missense	probably benign	0.30
R4006:Pla2r1	UTSW	2	60522873	missense	probably damaging	1.00
R4091:Pla2r1	UTSW	2	60432593	missense	probably damaging	1.00
R4158:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4160:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4168:Pla2r1	UTSW	2	60497614	nonsense	probably null
R4541:Pla2r1	UTSW	2	60427738	missense	probably damaging	1.00
R4712:Pla2r1	UTSW	2	60428650	missense	probably damaging	1.00
R4797:Pla2r1	UTSW	2	60504180	missense	possibly damaging	0.47
R4884:Pla2r1	UTSW	2	60534984	missense	probably damaging	1.00
R4923:Pla2r1	UTSW	2	60422712	missense	probably benign	0.31
R5017:Pla2r1	UTSW	2	60522760	splice site	probably null
R5116:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R5641:Pla2r1	UTSW	2	60514984	missense	probably damaging	1.00
R5807:Pla2r1	UTSW	2	60428721	missense	possibly damaging	0.78
R5898:Pla2r1	UTSW	2	60422760	missense	probably damaging	1.00
R6241:Pla2r1	UTSW	2	60502199	splice site	probably null
R6923:Pla2r1	UTSW	2	60514966	missense	probably benign	0.11
R7020:Pla2r1	UTSW	2	60447399	missense	possibly damaging	0.79
R7028:Pla2r1	UTSW	2	60458393	missense	probably damaging	0.98
R7257:Pla2r1	UTSW	2	60427625	critical splice donor site	probably null
R7291:Pla2r1	UTSW	2	60530435	missense	probably benign	0.43
R7350:Pla2r1	UTSW	2	60458379	missense	probably benign	0.02
R7451:Pla2r1	UTSW	2	60535002	missense	probably damaging	1.00
R7553:Pla2r1	UTSW	2	60522899	missense	possibly damaging	0.80
R7635:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R7768:Pla2r1	UTSW	2	60448946	missense	probably benign	0.22
R7774:Pla2r1	UTSW	2	60530458	nonsense	probably null
R7782:Pla2r1	UTSW	2	60504187	missense	probably benign	0.01
R7832:Pla2r1	UTSW	2	60504192	missense	possibly damaging	0.79
R7843:Pla2r1	UTSW	2	60447475	missense	possibly damaging	0.88
R7900:Pla2r1	UTSW	2	60428514	missense	possibly damaging	0.94
R8010:Pla2r1	UTSW	2	60514960	missense	probably benign	0.00
R8129:Pla2r1	UTSW	2	60432600	missense	probably damaging	1.00
R8336:Pla2r1	UTSW	2	60422683	missense	possibly damaging	0.88
R8347:Pla2r1	UTSW	2	60534903	missense	probably damaging	0.98
R8359:Pla2r1	UTSW	2	60443283	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTAGGCATGGTACTTCAGGATGGC -3'
(R):5'- TCCTGGCTTCCTACAAGGCGAG -3'

Sequencing Primer
(F):5'- ATGGCCGGGGTCACTTAC -3'
(R):5'- ACAACCAAAGTAGTTCTCTAGTCAG -3'

Posted On

2013-05-09