Incidental Mutation 'R0105:Olfr1202'
Institutional Source Beutler Lab
Gene Symbol Olfr1202
Ensembl Gene ENSMUSG00000064084
Gene Nameolfactory receptor 1202
SynonymsMOR232-7, GA_x6K02T2Q125-50290367-50291296
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0105 (G1)
Quality Score218
Status Validated (trace)
Chromosomal Location88814496-88820711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88817909 bp
Amino Acid Change Valine to Aspartic acid at position 246 (V246D)
Ref Sequence ENSEMBL: ENSMUSP00000150743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057] [ENSMUST00000214703] [ENSMUST00000217059]
Predicted Effect probably damaging
Transcript: ENSMUST00000072057
AA Change: V246D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: V246D

Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214703
AA Change: V246D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217059
AA Change: V246D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Olfr1202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Olfr1202 APN 2 88817437 missense possibly damaging 0.54
R0699:Olfr1202 UTSW 2 88817224 missense probably damaging 1.00
R0709:Olfr1202 UTSW 2 88817882 missense probably benign 0.42
R1177:Olfr1202 UTSW 2 88817360 missense probably benign 0.06
R1436:Olfr1202 UTSW 2 88817992 missense possibly damaging 0.48
R1827:Olfr1202 UTSW 2 88818058 missense probably benign 0.04
R1828:Olfr1202 UTSW 2 88818058 missense probably benign 0.04
R1872:Olfr1202 UTSW 2 88817936 missense probably benign 0.02
R1878:Olfr1202 UTSW 2 88817461 missense probably benign 0.00
R4903:Olfr1202 UTSW 2 88817998 missense probably benign 0.14
R5035:Olfr1202 UTSW 2 88818099 missense probably benign 0.01
R6279:Olfr1202 UTSW 2 88817375 missense probably damaging 1.00
R7402:Olfr1202 UTSW 2 88817343 missense probably damaging 1.00
R7809:Olfr1202 UTSW 2 88817558 missense probably damaging 0.96
R8172:Olfr1202 UTSW 2 88817642 missense probably damaging 1.00
R8193:Olfr1202 UTSW 2 88817459 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctgtctgtctgtctatctgtctg -3'
Posted On2013-05-09