Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Tgm5'

33241

Institutional Source

Beutler Lab

Gene Symbol

Tgm5

Ensembl Gene

ENSMUSG00000053675

Gene Name

transglutaminase 5

Synonyms

2310007C07Rik, TGx

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R0105 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

121046111-121085841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 121077012 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 77 (G77W)

Ref Sequence

ENSEMBL: ENSMUSP00000028721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028721]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028721
AA Change: G77W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: G77W

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	11	127	1.4e-31	PFAM
TGc	275	368	1.86e-49	SMART
Pfam:Transglut_C	511	610	2.5e-23	PFAM
Pfam:Transglut_C	624	722	1.8e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142674

Meta Mutation Damage Score

0.238

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Tgm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Tgm5	APN	2	121071496	missense	probably benign	0.01
IGL01148:Tgm5	APN	2	121046675	splice site	probably null
IGL01284:Tgm5	APN	2	121052547	missense	possibly damaging	0.94
IGL01370:Tgm5	APN	2	121053537	missense	probably benign	0.03
IGL01545:Tgm5	APN	2	121052808	missense	probably damaging	1.00
IGL01547:Tgm5	APN	2	121049202	splice site	probably benign
IGL01998:Tgm5	APN	2	121052439	missense	probably damaging	1.00
IGL02577:Tgm5	APN	2	121077603	missense	probably benign	0.01
IGL02636:Tgm5	APN	2	121076796	missense	probably damaging	0.99
PIT4283001:Tgm5	UTSW	2	121071585	missense	possibly damaging	0.48
R0001:Tgm5	UTSW	2	121077646	missense	probably damaging	1.00
R0013:Tgm5	UTSW	2	121076882	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0117:Tgm5	UTSW	2	121075102	critical splice donor site	probably null
R0145:Tgm5	UTSW	2	121077581	missense	possibly damaging	0.93
R0356:Tgm5	UTSW	2	121053574	missense	probably damaging	1.00
R0410:Tgm5	UTSW	2	121077558	missense	possibly damaging	0.46
R0519:Tgm5	UTSW	2	121048895	missense	probably damaging	1.00
R1674:Tgm5	UTSW	2	121071544	missense	possibly damaging	0.60
R1773:Tgm5	UTSW	2	121077650	missense	possibly damaging	0.67
R1864:Tgm5	UTSW	2	121075218	missense	probably damaging	1.00
R2276:Tgm5	UTSW	2	121048823	splice site	probably benign
R2511:Tgm5	UTSW	2	121076948	missense	possibly damaging	0.62
R4180:Tgm5	UTSW	2	121076961	missense	probably benign	0.13
R4230:Tgm5	UTSW	2	121070735	missense	probably damaging	1.00
R4801:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R4802:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R5840:Tgm5	UTSW	2	121085660	critical splice donor site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R7064:Tgm5	UTSW	2	121053514	missense	probably benign	0.04
R7102:Tgm5	UTSW	2	121046498	missense	possibly damaging	0.89
R7114:Tgm5	UTSW	2	121048496	nonsense	probably null
R7178:Tgm5	UTSW	2	121085768	start gained	probably benign
V3553:Tgm5	UTSW	2	121071502	missense	probably damaging	1.00
X0065:Tgm5	UTSW	2	121070839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTCGATCCGAATTTTCAGGAGG -3'
(R):5'- TTCCAGCCAGGCATGGACAGTATC -3'

Sequencing Primer
(F):5'- AATTTTCAGGAGGTATCGGCCC -3'
(R):5'- tgtgtgggggtgtgtgg -3'

Posted On

2013-05-09