Incidental Mutation 'R0105:Il6ra'
ID33244
Institutional Source Beutler Lab
Gene Symbol Il6ra
Ensembl Gene ENSMUSG00000027947
Gene Nameinterleukin 6 receptor, alpha
SynonymsIL-6R, IL-6 receptor alpha chain, Il6r, CD126
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location89864059-89913196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89876818 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 382 (I382T)
Ref Sequence ENSEMBL: ENSMUSP00000143541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029559] [ENSMUST00000197679]
Predicted Effect probably damaging
Transcript: ENSMUST00000029559
AA Change: I383T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029559
Gene: ENSMUSG00000027947
AA Change: I383T

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
IGc2 38 99 1.35e-9 SMART
Pfam:IL6Ra-bind 109 210 2.9e-21 PFAM
FN3 213 298 2.18e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197679
AA Change: I382T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143541
Gene: ENSMUSG00000027947
AA Change: I382T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 38 99 5.7e-12 SMART
Pfam:IL6Ra-bind 109 210 6.8e-19 PFAM
FN3 213 298 1.1e-4 SMART
transmembrane domain 362 384 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
Meta Mutation Damage Score 0.3910 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit defective T helper 17 cells development. Mice homozygous for a different knock-out allele exhibit abnormaly inflammatory response and abnormal wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Il6ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Il6ra APN 3 89886043 missense probably damaging 0.97
IGL02198:Il6ra APN 3 89890348 missense probably benign 0.07
IGL02363:Il6ra APN 3 89871253 missense probably benign 0.00
IGL03109:Il6ra APN 3 89876858 nonsense probably null
R0569:Il6ra UTSW 3 89877842 critical splice donor site probably null
R0926:Il6ra UTSW 3 89887069 missense probably damaging 0.99
R1837:Il6ra UTSW 3 89890272 missense probably benign 0.00
R1838:Il6ra UTSW 3 89890272 missense probably benign 0.00
R3147:Il6ra UTSW 3 89885928 missense probably benign 0.29
R4478:Il6ra UTSW 3 89890290 missense probably damaging 1.00
R5470:Il6ra UTSW 3 89885995 missense probably benign 0.05
R5572:Il6ra UTSW 3 89871282 missense probably damaging 1.00
R6169:Il6ra UTSW 3 89871291 missense probably benign 0.15
R6300:Il6ra UTSW 3 89887129 missense probably damaging 0.97
R6543:Il6ra UTSW 3 89876863 missense probably damaging 1.00
R7129:Il6ra UTSW 3 89871247 missense probably damaging 0.99
R8023:Il6ra UTSW 3 89912953 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTCAGCACTTCCTTGTCAGGGC -3'
(R):5'- GGGAAAGCTACTCTGAGCGTGAAC -3'

Sequencing Primer
(F):5'- GGCTTCCTCACTACACAGTACC -3'
(R):5'- CCTGActttcttttccctctttcc -3'
Posted On2013-05-09