Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Mroh7'

33246

Institutional Source

Beutler Lab

Gene Symbol

Mroh7

Ensembl Gene

ENSMUSG00000047502

Gene Name

maestro heat-like repeat family member 7

Synonyms

Heatr8, LOC381538, Gm1027

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0105 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

106680417-106730925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106711270 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 48 (T48A)

Ref Sequence

ENSEMBL: ENSMUSP00000117581 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106770] [ENSMUST00000145044]

Predicted Effect

probably benign
Transcript: ENSMUST00000106770
AA Change: T413A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: T413A

Domain	Start	End	E-Value	Type
low complexity region	39	61	N/A	INTRINSIC
low complexity region	318	332	N/A	INTRINSIC
low complexity region	563	573	N/A	INTRINSIC
SCOP:d1b3ua_	634	1218	6e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145044
AA Change: T48A

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145374

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Mroh7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01722:Mroh7	APN	4	106703161	missense	probably benign	0.00
IGL01729:Mroh7	APN	4	106704205	missense	possibly damaging	0.66
IGL01834:Mroh7	APN	4	106680874	missense	probably benign	0.00
IGL02003:Mroh7	APN	4	106702529	missense	probably damaging	0.96
IGL02135:Mroh7	APN	4	106702510	missense	probably damaging	1.00
IGL02335:Mroh7	APN	4	106707782	missense	probably damaging	1.00
IGL02532:Mroh7	APN	4	106720591	missense	probably benign	0.04
IGL02896:Mroh7	APN	4	106699816	missense	possibly damaging	0.94
IGL03066:Mroh7	APN	4	106692398	missense	possibly damaging	0.85
IGL03298:Mroh7	APN	4	106714091	nonsense	probably null
holy	UTSW	4	106709955	splice site	probably null
moley	UTSW	4	106694312	splice site	probably null
P0016:Mroh7	UTSW	4	106707857	critical splice acceptor site	probably null
R0019:Mroh7	UTSW	4	106721426	missense	probably benign	0.07
R0094:Mroh7	UTSW	4	106703184	missense	probably damaging	0.98
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0515:Mroh7	UTSW	4	106691664	missense	probably benign	0.01
R0828:Mroh7	UTSW	4	106699876	missense	probably damaging	0.99
R0831:Mroh7	UTSW	4	106680793	missense	possibly damaging	0.92
R1107:Mroh7	UTSW	4	106707594	splice site	probably null
R1301:Mroh7	UTSW	4	106720495	missense	probably damaging	0.99
R1456:Mroh7	UTSW	4	106695141	splice site	probably benign
R1491:Mroh7	UTSW	4	106703058	missense	probably benign	0.11
R1540:Mroh7	UTSW	4	106703076	missense	probably benign	0.11
R1560:Mroh7	UTSW	4	106711254	missense	possibly damaging	0.78
R1645:Mroh7	UTSW	4	106720668	missense	probably benign	0.19
R1804:Mroh7	UTSW	4	106694392	missense	possibly damaging	0.76
R2162:Mroh7	UTSW	4	106700181	missense	probably damaging	0.96
R2265:Mroh7	UTSW	4	106720927	missense	probably benign	0.01
R2866:Mroh7	UTSW	4	106691090	missense	probably damaging	1.00
R3716:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R3718:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R4530:Mroh7	UTSW	4	106720437	missense	possibly damaging	0.71
R4661:Mroh7	UTSW	4	106691513	critical splice donor site	probably null
R4706:Mroh7	UTSW	4	106691624	missense	possibly damaging	0.86
R4910:Mroh7	UTSW	4	106709955	splice site	probably null
R4965:Mroh7	UTSW	4	106690987	missense	possibly damaging	0.77
R4969:Mroh7	UTSW	4	106680873	missense	probably benign
R4971:Mroh7	UTSW	4	106691552	missense	probably benign	0.04
R5083:Mroh7	UTSW	4	106690318	missense	probably benign	0.03
R5207:Mroh7	UTSW	4	106721386	missense	probably damaging	0.97
R5364:Mroh7	UTSW	4	106691643	missense	probably benign	0.10
R5392:Mroh7	UTSW	4	106711251	critical splice donor site	probably null
R5630:Mroh7	UTSW	4	106720567	missense	possibly damaging	0.71
R5691:Mroh7	UTSW	4	106702618	missense	probably damaging	0.96
R5703:Mroh7	UTSW	4	106708560	missense	possibly damaging	0.77
R5707:Mroh7	UTSW	4	106681885	missense	possibly damaging	0.73
R5919:Mroh7	UTSW	4	106694312	splice site	probably null
R5979:Mroh7	UTSW	4	106720926	missense	probably benign	0.00
R6479:Mroh7	UTSW	4	106703188	missense	possibly damaging	0.75
R6520:Mroh7	UTSW	4	106721263	missense	probably benign	0.00
R6657:Mroh7	UTSW	4	106702500	nonsense	probably null
R6732:Mroh7	UTSW	4	106680713	frame shift	probably null
R6817:Mroh7	UTSW	4	106714115	missense	probably benign	0.00
R6980:Mroh7	UTSW	4	106700237	missense	probably benign	0.05
R7062:Mroh7	UTSW	4	106683980	missense	probably damaging	1.00
R7116:Mroh7	UTSW	4	106711320	missense	probably benign	0.07
R7134:Mroh7	UTSW	4	106720594	missense	probably damaging	0.99
R7169:Mroh7	UTSW	4	106691639	missense	probably damaging	0.99
R7419:Mroh7	UTSW	4	106683918	missense	probably benign
R7516:Mroh7	UTSW	4	106691119	missense	probably benign	0.00
R7525:Mroh7	UTSW	4	106709702	missense	probably benign	0.22
R7540:Mroh7	UTSW	4	106720398	missense	possibly damaging	0.85
R7849:Mroh7	UTSW	4	106721090	missense	probably benign
R7920:Mroh7	UTSW	4	106707576	missense	probably benign
R7998:Mroh7	UTSW	4	106711281	missense	probably benign	0.02
R8026:Mroh7	UTSW	4	106721437	missense	probably benign	0.01
R8122:Mroh7	UTSW	4	106702529	missense	probably damaging	0.96
R8249:Mroh7	UTSW	4	106721212	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTTAAGTCCTCCCACAGGCAAAG -3'
(R):5'- GGGTGCTGCATTATGCTGCCTAAG -3'

Sequencing Primer
(F):5'- acttgtccatactccctcttgtc -3'
(R):5'- CATTATGCTGCCTAAGGGGAG -3'

Posted On

2013-05-09