Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Atp6v0a4'

33253

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a4

Ensembl Gene

ENSMUSG00000038600

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A4

Synonyms

V-ATPase alpha 4, Atp6n1b

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0105 (G1)

Quality Score

212

Status

Validated (trace)

Chromosome

Chromosomal Location

38048483-38124586 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 38053129 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110558 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]

Predicted Effect

probably benign
Transcript: ENSMUST00000040259

SMART Domains

Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	824	3.5e-293	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114908

SMART Domains

Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	823	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135594

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Atp6v0a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Atp6v0a4	APN	6	38092790	nonsense	probably null
IGL01358:Atp6v0a4	APN	6	38074210	missense	probably damaging	1.00
IGL01781:Atp6v0a4	APN	6	38074160	missense	possibly damaging	0.91
IGL01934:Atp6v0a4	APN	6	38051546	missense	possibly damaging	0.90
IGL01953:Atp6v0a4	APN	6	38054617	missense	probably damaging	0.97
IGL03190:Atp6v0a4	APN	6	38054556	missense	probably benign	0.02
R0049:Atp6v0a4	UTSW	6	38082081	missense	probably damaging	1.00
R0049:Atp6v0a4	UTSW	6	38082081	missense	probably damaging	1.00
R0100:Atp6v0a4	UTSW	6	38076815	missense	probably benign
R1569:Atp6v0a4	UTSW	6	38050625	missense	probably damaging	1.00
R1754:Atp6v0a4	UTSW	6	38067829	missense	probably benign
R2142:Atp6v0a4	UTSW	6	38082936	nonsense	probably null
R2162:Atp6v0a4	UTSW	6	38088646	missense	possibly damaging	0.89
R2433:Atp6v0a4	UTSW	6	38082029	critical splice donor site	probably null
R2892:Atp6v0a4	UTSW	6	38053017	missense	probably benign	0.00
R4599:Atp6v0a4	UTSW	6	38078802	missense	probably benign	0.01
R4687:Atp6v0a4	UTSW	6	38092465	missense	possibly damaging	0.95
R4716:Atp6v0a4	UTSW	6	38061064	missense	probably damaging	1.00
R4938:Atp6v0a4	UTSW	6	38078814	missense	possibly damaging	0.80
R5062:Atp6v0a4	UTSW	6	38074183	missense	probably benign	0.05
R5437:Atp6v0a4	UTSW	6	38076733	missense	probably damaging	0.97
R5440:Atp6v0a4	UTSW	6	38092817	missense	probably damaging	0.96
R5697:Atp6v0a4	UTSW	6	38050507	splice site	probably null
R5698:Atp6v0a4	UTSW	6	38050507	splice site	probably null
R6425:Atp6v0a4	UTSW	6	38050511	missense	possibly damaging	0.88
R7659:Atp6v0a4	UTSW	6	38071972	missense	probably damaging	1.00
R8004:Atp6v0a4	UTSW	6	38050549	missense	possibly damaging	0.93
R8270:Atp6v0a4	UTSW	6	38074229	missense	probably damaging	1.00
Z1176:Atp6v0a4	UTSW	6	38049036	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGCTGCACCCTTGTGACTGTAAAG -3'
(R):5'- ATGGCTCCCCGATGTTTTCTGTTAG -3'

Sequencing Primer
(F):5'- CCCTTGTGACTGTAAAGATCATATCC -3'
(R):5'- cgagacagggtttctctgtg -3'

Posted On

2013-05-09