Incidental Mutation 'R0105:Atp6v0a4'
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene NameATPase, H+ transporting, lysosomal V0 subunit A4
SynonymsV-ATPase alpha 4, Atp6n1b
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0105 (G1)
Quality Score212
Status Validated (trace)
Chromosomal Location38048483-38124586 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 38053129 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
Predicted Effect probably benign
Transcript: ENSMUST00000040259
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600

Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114908
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600

Pfam:V_ATPase_I 27 823 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135594
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cgagacagggtttctctgtg -3'
Posted On2013-05-09