Incidental Mutation 'R0105:Lrrk1'
ID33262
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66292341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 716 (D716E)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277]
Predicted Effect probably damaging
Transcript: ENSMUST00000015277
AA Change: D716E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: D716E

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Meta Mutation Damage Score 0.1301 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7728:Lrrk1 UTSW 7 66262715 missense probably benign 0.00
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCTTCAGACCACAGAACCGTG -3'
(R):5'- ATGATCTCCTCAGAGACCCTGCTC -3'

Sequencing Primer
(F):5'- CAATGTTGAGCAGCCAGAAC -3'
(R):5'- TTCCTAAGACACACTGGAGTCTG -3'
Posted On2013-05-09