Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Gab2'

33263

Institutional Source

Beutler Lab

Gene Symbol

Gab2

Ensembl Gene

ENSMUSG00000004508

Gene Name

growth factor receptor bound protein 2-associated protein 2

Synonyms

D130058I17Rik, p97

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.504) question?

Stock #

R0105 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

97081586-97308946 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97299072 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 290 (Y290H)

Ref Sequence

ENSEMBL: ENSMUSP00000146200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000206791]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004622
AA Change: Y290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508
AA Change: Y290H

Domain	Start	End	E-Value	Type
PH	9	121	1.07e-22	SMART
Blast:PH	268	314	4e-11	BLAST
low complexity region	348	355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000206791
AA Change: Y290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.3334

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein (GAB) gene family. These proteins contain pleckstrin homology (PH) domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. They act as adapters for transmitting various signals in response to stimuli through cytokine and growth factor receptors, and T- and B-cell antigen receptors. The protein encoded by this gene is the principal activator of phosphatidylinositol-3 kinase in response to activation of the high affinity IgE receptor. Two alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in passive cutaneous and systemic anaphylaxis, Fc gamma receptor-mediated phagocytosis, and mast cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Gab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Gab2	APN	7	97302443	missense	possibly damaging	0.91
IGL00325:Gab2	APN	7	97299258	missense	probably damaging	1.00
IGL01832:Gab2	APN	7	97304238	missense	probably damaging	1.00
IGL01955:Gab2	APN	7	97304223	missense	probably damaging	1.00
IGL02664:Gab2	APN	7	97304182	missense	probably damaging	1.00
R0105:Gab2	UTSW	7	97299072	missense	probably damaging	1.00
R0243:Gab2	UTSW	7	97299241	missense	probably damaging	0.96
R0827:Gab2	UTSW	7	97300332	missense	probably damaging	1.00
R1696:Gab2	UTSW	7	97223633	missense	probably damaging	1.00
R1872:Gab2	UTSW	7	97299043	missense	probably damaging	0.99
R2973:Gab2	UTSW	7	97223552	missense	probably benign	0.07
R3195:Gab2	UTSW	7	97272029	missense	probably benign
R3827:Gab2	UTSW	7	97223741	missense	probably damaging	1.00
R3910:Gab2	UTSW	7	97299073	missense	probably damaging	1.00
R3911:Gab2	UTSW	7	97299073	missense	probably damaging	1.00
R3912:Gab2	UTSW	7	97299073	missense	probably damaging	1.00
R4604:Gab2	UTSW	7	97304213	missense	probably damaging	0.99
R5506:Gab2	UTSW	7	97303113	missense	probably damaging	1.00
R5655:Gab2	UTSW	7	97298892	missense	probably benign
R6299:Gab2	UTSW	7	97081859	missense	probably benign	0.00
R7038:Gab2	UTSW	7	97303083	missense	probably damaging	1.00
R7313:Gab2	UTSW	7	97081798	start gained	probably benign
R7586:Gab2	UTSW	7	97301438	missense	probably damaging	1.00
R7729:Gab2	UTSW	7	97301426	missense	probably damaging	1.00
R8434:Gab2	UTSW	7	97299130	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGCCCAGAGCAATGGACAC -3'
(R):5'- GCTCCAGATTACACTGACCTCGATG -3'

Sequencing Primer
(F):5'- TGGACACTGTATCAACGGC -3'
(R):5'- GATTACACTGACCTCGATGGAGTC -3'

Posted On

2013-05-09