Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Cgnl1'

33270

Institutional Source

Beutler Lab

Gene Symbol

Cgnl1

Ensembl Gene

ENSMUSG00000032232

Gene Name

cingulin-like 1

Synonyms

Jacop, 9930020M10Rik, 4933421H10Rik

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0105 (G1)

Quality Score

128

Status

Validated (trace)

Chromosome

Chromosomal Location

71626509-71771602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71656102 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 848 (M848V)

Ref Sequence

ENSEMBL: ENSMUSP00000112479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]

Predicted Effect

probably benign
Transcript: ENSMUST00000072899
AA Change: M848V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: M848V

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
low complexity region	728	739	N/A	INTRINSIC
Pfam:Myosin_tail_1	984	1255	5.4e-30	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121322
AA Change: M777V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: M777V

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
Pfam:Myosin_tail_1	909	1184	2.3e-30	PFAM
low complexity region	1187	1207	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122065
AA Change: M848V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: M848V

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
Pfam:Myosin_tail_1	582	1034	1.3e-12	PFAM
Pfam:Myosin_tail_1	1011	1253	7.7e-38	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Cgnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Cgnl1	APN	9	71656056	missense	probably benign	0.00
IGL01128:Cgnl1	APN	9	71724561	missense	possibly damaging	0.81
IGL01450:Cgnl1	APN	9	71631862	splice site	probably benign
IGL01788:Cgnl1	APN	9	71655390	missense	probably benign
IGL01806:Cgnl1	APN	9	71650322	missense	probably damaging	0.99
IGL01906:Cgnl1	APN	9	71724567	missense	probably benign	0.00
IGL01933:Cgnl1	APN	9	71645483	splice site	probably benign
IGL01939:Cgnl1	APN	9	71725004	missense	probably damaging	1.00
IGL01947:Cgnl1	APN	9	71725044	missense	probably damaging	0.99
IGL02127:Cgnl1	APN	9	71725853	missense	probably damaging	1.00
IGL02379:Cgnl1	APN	9	71645553	missense	possibly damaging	0.82
IGL02510:Cgnl1	APN	9	71725357	missense	probably benign	0.41
FR4548:Cgnl1	UTSW	9	71724717	small insertion	probably benign
R0058:Cgnl1	UTSW	9	71641397	missense	probably damaging	1.00
R0058:Cgnl1	UTSW	9	71724840	missense	probably damaging	0.99
R0220:Cgnl1	UTSW	9	71724943	missense	possibly damaging	0.68
R0242:Cgnl1	UTSW	9	71721657	missense	probably damaging	1.00
R0401:Cgnl1	UTSW	9	71705239	missense	probably damaging	1.00
R0541:Cgnl1	UTSW	9	71651253	missense	possibly damaging	0.54
R1018:Cgnl1	UTSW	9	71726058	missense	probably damaging	1.00
R1026:Cgnl1	UTSW	9	71717431	missense	possibly damaging	0.91
R1056:Cgnl1	UTSW	9	71725895	missense	probably damaging	1.00
R1299:Cgnl1	UTSW	9	71721712	splice site	probably benign
R1513:Cgnl1	UTSW	9	71724590	missense	probably benign	0.02
R1546:Cgnl1	UTSW	9	71725815	missense	probably benign
R1599:Cgnl1	UTSW	9	71641427	missense	probably benign	0.02
R1657:Cgnl1	UTSW	9	71725944	missense	probably damaging	0.98
R1970:Cgnl1	UTSW	9	71725535	missense	probably benign	0.10
R2004:Cgnl1	UTSW	9	71630539	missense	probably damaging	1.00
R2080:Cgnl1	UTSW	9	71656096	missense	probably benign	0.01
R2085:Cgnl1	UTSW	9	71630878	missense	probably damaging	1.00
R2357:Cgnl1	UTSW	9	71725668	nonsense	probably null
R2402:Cgnl1	UTSW	9	71725179	missense	probably damaging	1.00
R3954:Cgnl1	UTSW	9	71724663	missense	probably benign	0.01
R4043:Cgnl1	UTSW	9	71705293	missense	probably damaging	1.00
R4127:Cgnl1	UTSW	9	71724540	missense	probably benign	0.00
R4825:Cgnl1	UTSW	9	71630524	missense	probably benign	0.00
R4851:Cgnl1	UTSW	9	71725032	missense	probably damaging	1.00
R4882:Cgnl1	UTSW	9	71717401	missense	probably benign	0.00
R4996:Cgnl1	UTSW	9	71724826	small deletion	probably benign
R5057:Cgnl1	UTSW	9	71724794	missense	probably damaging	0.99
R5263:Cgnl1	UTSW	9	71632654	nonsense	probably null
R5402:Cgnl1	UTSW	9	71629321	missense	probably damaging	1.00
R5744:Cgnl1	UTSW	9	71630675	splice site	probably null
R5770:Cgnl1	UTSW	9	71645487	splice site	probably null
R6911:Cgnl1	UTSW	9	71656215	missense	possibly damaging	0.82
R7014:Cgnl1	UTSW	9	71725134	missense	possibly damaging	0.86
R7106:Cgnl1	UTSW	9	71725733	missense	probably benign	0.00
R7203:Cgnl1	UTSW	9	71724533	missense	possibly damaging	0.80
R7231:Cgnl1	UTSW	9	71632645	missense	probably benign	0.39
R7241:Cgnl1	UTSW	9	71724770	missense	probably benign
R7288:Cgnl1	UTSW	9	71725564	missense	possibly damaging	0.67
R7327:Cgnl1	UTSW	9	71725883	missense	possibly damaging	0.48
R7390:Cgnl1	UTSW	9	71645649	missense	probably benign	0.04
R7529:Cgnl1	UTSW	9	71631758	missense	probably damaging	1.00
R7793:Cgnl1	UTSW	9	71725635	missense	probably damaging	1.00
R7975:Cgnl1	UTSW	9	71725322	missense	probably benign	0.00
R7990:Cgnl1	UTSW	9	71725265	missense	probably damaging	1.00
R8502:Cgnl1	UTSW	9	71630605	missense	probably damaging	0.99
RF015:Cgnl1	UTSW	9	71724715	small insertion	probably benign
RF042:Cgnl1	UTSW	9	71724715	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGATGCCTGAGTCTCTGGGAAC -3'
(R):5'- TCCAGCAGCAACTTCCTTCACG -3'

Sequencing Primer
(F):5'- CTCTGGGAACTGTGTGGC -3'
(R):5'- GTTGGGGACCACCTATGAATACTC -3'

Posted On

2013-05-09