Incidental Mutation 'R0105:Cgnl1'
ID33270
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Namecingulin-like 1
SynonymsJacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0105 (G1)
Quality Score128
Status Validated (trace)
Chromosome9
Chromosomal Location71626509-71771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71656102 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 848 (M848V)
Ref Sequence ENSEMBL: ENSMUSP00000112479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
Predicted Effect probably benign
Transcript: ENSMUST00000072899
AA Change: M848V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: M848V

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121322
AA Change: M777V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: M777V

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122065
AA Change: M848V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: M848V

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71656096 missense probably benign 0.01
R2085:Cgnl1 UTSW 9 71630878 missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 intron probably null
R5770:Cgnl1 UTSW 9 71645487 splice site probably null
R6911:Cgnl1 UTSW 9 71656215 missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7288:Cgnl1 UTSW 9 71725564 missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71725883 missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGATGCCTGAGTCTCTGGGAAC -3'
(R):5'- TCCAGCAGCAACTTCCTTCACG -3'

Sequencing Primer
(F):5'- CTCTGGGAACTGTGTGGC -3'
(R):5'- GTTGGGGACCACCTATGAATACTC -3'
Posted On2013-05-09