Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Mcm3ap'

33274

Institutional Source

Beutler Lab

Gene Symbol

Mcm3ap

Ensembl Gene

ENSMUSG00000001150

Gene Name

minichromosome maintenance complex component 3 associated protein

Synonyms

GANP

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0105 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

76468927-76515857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76499534 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1263 (D1263E)

Ref Sequence

ENSEMBL: ENSMUSP00000125960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170795]

Predicted Effect

probably damaging
Transcript: ENSMUST00000170795
AA Change: D1263E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: D1263E

Domain	Start	End	E-Value	Type
Pfam:NupH_GANP	2	286	3.3e-108	PFAM
low complexity region	389	403	N/A	INTRINSIC
Blast:RRM	430	504	5e-39	BLAST
SCOP:d1fjeb2	434	500	6e-4	SMART
low complexity region	544	559	N/A	INTRINSIC
low complexity region	570	586	N/A	INTRINSIC
Pfam:SAC3_GANP	677	903	1.7e-82	PFAM
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1024	1035	N/A	INTRINSIC
low complexity region	1039	1053	N/A	INTRINSIC
low complexity region	1091	1110	N/A	INTRINSIC
low complexity region	1133	1155	N/A	INTRINSIC
Pfam:CID_GANP	1156	1226	1.6e-33	PFAM
Pfam:MCM3AP_GANP	1254	1967	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219811

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Mcm3ap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Mcm3ap	APN	10	76471177	missense	probably benign	0.01
IGL00742:Mcm3ap	APN	10	76492935	missense	probably damaging	1.00
IGL00898:Mcm3ap	APN	10	76470325	missense	probably benign	0.00
IGL00984:Mcm3ap	APN	10	76499566	missense	probably damaging	1.00
IGL01591:Mcm3ap	APN	10	76470805	missense	probably benign
IGL01882:Mcm3ap	APN	10	76483184	missense	possibly damaging	0.71
IGL01973:Mcm3ap	APN	10	76471117	missense	probably benign	0.00
IGL02253:Mcm3ap	APN	10	76470065	missense	probably benign	0.40
IGL02304:Mcm3ap	APN	10	76484738	missense	possibly damaging	0.65
IGL02340:Mcm3ap	APN	10	76496552	nonsense	probably null
IGL02487:Mcm3ap	APN	10	76507555	unclassified	probably benign
IGL02488:Mcm3ap	APN	10	76499649	missense	probably damaging	1.00
IGL02640:Mcm3ap	APN	10	76506421	missense	probably damaging	1.00
IGL02714:Mcm3ap	APN	10	76511033	missense	probably benign	0.00
IGL02748:Mcm3ap	APN	10	76501248	missense	probably damaging	1.00
IGL02894:Mcm3ap	APN	10	76477767	missense	probably benign	0.00
IGL02903:Mcm3ap	APN	10	76471258	splice site	probably benign
IGL02955:Mcm3ap	APN	10	76507466	missense	probably benign	0.34
IGL02989:Mcm3ap	APN	10	76471060	missense	possibly damaging	0.48
IGL03003:Mcm3ap	APN	10	76504697	missense	probably benign	0.01
IGL03081:Mcm3ap	APN	10	76470316	missense	possibly damaging	0.86
IGL03218:Mcm3ap	APN	10	76482733	missense	probably damaging	1.00
IGL03401:Mcm3ap	APN	10	76484649	splice site	probably benign
Doom	UTSW	10	76501314	missense	probably benign
woeful	UTSW	10	76481015	missense	probably benign	0.44
PIT4377001:Mcm3ap	UTSW	10	76502762	missense	possibly damaging	0.78
PIT4791001:Mcm3ap	UTSW	10	76506473	missense	probably damaging	1.00
R0144:Mcm3ap	UTSW	10	76481015	missense	probably benign	0.44
R0423:Mcm3ap	UTSW	10	76502705	missense	probably benign	0.00
R0692:Mcm3ap	UTSW	10	76483169	missense	probably damaging	1.00
R1402:Mcm3ap	UTSW	10	76477914	unclassified	probably benign
R1441:Mcm3ap	UTSW	10	76471166	missense	probably benign
R1512:Mcm3ap	UTSW	10	76470513	missense	probably damaging	1.00
R1533:Mcm3ap	UTSW	10	76504287	missense	probably damaging	1.00
R1569:Mcm3ap	UTSW	10	76483188	missense	possibly damaging	0.80
R1590:Mcm3ap	UTSW	10	76496541	missense	probably benign	0.36
R1597:Mcm3ap	UTSW	10	76483226	missense	probably damaging	1.00
R1743:Mcm3ap	UTSW	10	76484674	missense	possibly damaging	0.53
R1773:Mcm3ap	UTSW	10	76471160	missense	probably benign
R1922:Mcm3ap	UTSW	10	76507361	missense	probably damaging	1.00
R2061:Mcm3ap	UTSW	10	76470068	missense	probably benign	0.43
R2097:Mcm3ap	UTSW	10	76512489	missense	probably damaging	1.00
R2436:Mcm3ap	UTSW	10	76490057	missense	probably damaging	1.00
R3684:Mcm3ap	UTSW	10	76489426	missense	possibly damaging	0.64
R3690:Mcm3ap	UTSW	10	76482679	missense	probably damaging	1.00
R3881:Mcm3ap	UTSW	10	76506446	missense	probably benign	0.21
R4296:Mcm3ap	UTSW	10	76507337	missense	probably damaging	1.00
R4677:Mcm3ap	UTSW	10	76470570	missense	probably damaging	1.00
R4786:Mcm3ap	UTSW	10	76488466	missense	probably benign	0.00
R4882:Mcm3ap	UTSW	10	76484661	nonsense	probably null
R4907:Mcm3ap	UTSW	10	76493441	missense	probably damaging	1.00
R5108:Mcm3ap	UTSW	10	76502702	missense	probably benign	0.04
R5279:Mcm3ap	UTSW	10	76507539	missense	probably damaging	0.96
R5316:Mcm3ap	UTSW	10	76470926	missense	possibly damaging	0.89
R5402:Mcm3ap	UTSW	10	76483314	missense	probably benign	0.04
R5459:Mcm3ap	UTSW	10	76496482	nonsense	probably null
R5473:Mcm3ap	UTSW	10	76502759	missense	probably damaging	1.00
R5570:Mcm3ap	UTSW	10	76481096	missense	possibly damaging	0.89
R5931:Mcm3ap	UTSW	10	76471166	missense	probably benign
R5939:Mcm3ap	UTSW	10	76508361	missense	probably benign	0.00
R5950:Mcm3ap	UTSW	10	76488419	missense	possibly damaging	0.46
R5998:Mcm3ap	UTSW	10	76481142	critical splice donor site	probably null
R6122:Mcm3ap	UTSW	10	76506607	missense	probably damaging	1.00
R6192:Mcm3ap	UTSW	10	76501100	missense	probably damaging	0.97
R6226:Mcm3ap	UTSW	10	76515706	missense	possibly damaging	0.95
R6293:Mcm3ap	UTSW	10	76471478	nonsense	probably null
R6669:Mcm3ap	UTSW	10	76507337	missense	probably damaging	0.98
R6715:Mcm3ap	UTSW	10	76489532	missense	possibly damaging	0.68
R6759:Mcm3ap	UTSW	10	76501314	missense	probably benign
R6864:Mcm3ap	UTSW	10	76507479	missense	probably damaging	1.00
R6870:Mcm3ap	UTSW	10	76470215	missense	probably benign	0.00
R6935:Mcm3ap	UTSW	10	76504253	missense	possibly damaging	0.84
R6947:Mcm3ap	UTSW	10	76515666	missense	probably benign	0.09
R7212:Mcm3ap	UTSW	10	76501311	missense	probably benign	0.01
R7403:Mcm3ap	UTSW	10	76482823	critical splice donor site	probably null
R7470:Mcm3ap	UTSW	10	76508397	missense	probably damaging	1.00
R7561:Mcm3ap	UTSW	10	76492878	missense	possibly damaging	0.94
R7610:Mcm3ap	UTSW	10	76496720	splice site	probably null
R7620:Mcm3ap	UTSW	10	76470433	missense	probably benign	0.00
R7898:Mcm3ap	UTSW	10	76506607	missense	probably damaging	1.00
R8266:Mcm3ap	UTSW	10	76476580	nonsense	probably null
R8367:Mcm3ap	UTSW	10	76477859	missense	possibly damaging	0.65
X0026:Mcm3ap	UTSW	10	76482785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTTGTACTTACGTCCAGCAGCTC -3'
(R):5'- TGGGAAACACAGCCTTCAAGATGC -3'

Sequencing Primer
(F):5'- gactggagagatggcttagtg -3'
(R):5'- CCATCTTTAGCTGCAAAGTCATCAG -3'

Posted On

2013-05-09