Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Pik3r5'

33276

Institutional Source

Beutler Lab

Gene Symbol

Pik3r5

Ensembl Gene

ENSMUSG00000020901

Gene Name

phosphoinositide-3-kinase regulatory subunit 5

Synonyms

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R0105 (G1)

Quality Score

173

Status

Validated (trace)

Chromosome

Chromosomal Location

68432121-68497849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68490511 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 174 (E174D)

Ref Sequence

ENSEMBL: ENSMUSP00000021283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021283]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021283
AA Change: E174D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: E174D

Domain	Start	End	E-Value	Type
Pfam:PI3K_1B_p101	6	871	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155887

Meta Mutation Damage Score

0.0268

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Pik3r5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Pik3r5	APN	11	68496194	missense	possibly damaging	0.68
IGL01400:Pik3r5	APN	11	68494547	missense	probably benign	0.01
IGL01597:Pik3r5	APN	11	68496001	missense	probably damaging	1.00
IGL01622:Pik3r5	APN	11	68486626	splice site	probably null
IGL01623:Pik3r5	APN	11	68486626	splice site	probably null
IGL01878:Pik3r5	APN	11	68492530	missense	probably benign	0.00
IGL01953:Pik3r5	APN	11	68494171	missense	probably benign	0.00
IGL02056:Pik3r5	APN	11	68490855	missense	possibly damaging	0.86
IGL02345:Pik3r5	APN	11	68492726	missense	probably benign	0.03
palmetto	UTSW	11	68494233	missense	probably damaging	1.00
Palmito	UTSW	11	68492000	missense	probably damaging	1.00
palms	UTSW	11	68486622	critical splice donor site	probably null
piranha	UTSW	11	68486581	missense	probably damaging	1.00
Serenoa_repens	UTSW	11	68475424	nonsense	probably null
IGL02799:Pik3r5	UTSW	11	68495947	missense	probably damaging	0.98
R0077:Pik3r5	UTSW	11	68486622	critical splice donor site	probably null
R0092:Pik3r5	UTSW	11	68492803	missense	probably benign
R0118:Pik3r5	UTSW	11	68490480	missense	probably damaging	1.00
R1204:Pik3r5	UTSW	11	68494224	missense	probably benign	0.03
R1447:Pik3r5	UTSW	11	68494177	missense	probably benign	0.18
R1865:Pik3r5	UTSW	11	68492492	missense	probably damaging	1.00
R2034:Pik3r5	UTSW	11	68493577	missense	probably damaging	0.99
R2356:Pik3r5	UTSW	11	68492917	missense	probably damaging	1.00
R4588:Pik3r5	UTSW	11	68493261	intron	probably benign
R4716:Pik3r5	UTSW	11	68495204	missense	possibly damaging	0.48
R4960:Pik3r5	UTSW	11	68493638	missense	probably benign	0.19
R5217:Pik3r5	UTSW	11	68491964	missense	possibly damaging	0.67
R5518:Pik3r5	UTSW	11	68477468	missense	possibly damaging	0.86
R5528:Pik3r5	UTSW	11	68495977	missense	probably damaging	1.00
R5554:Pik3r5	UTSW	11	68494233	missense	probably damaging	1.00
R5693:Pik3r5	UTSW	11	68494251	missense	probably damaging	1.00
R5841:Pik3r5	UTSW	11	68492270	missense	probably damaging	1.00
R6025:Pik3r5	UTSW	11	68492318	missense	probably damaging	0.97
R6168:Pik3r5	UTSW	11	68492675	missense	probably benign
R6243:Pik3r5	UTSW	11	68492000	missense	probably damaging	1.00
R6322:Pik3r5	UTSW	11	68492741	missense	probably benign
R6420:Pik3r5	UTSW	11	68475424	nonsense	probably null
R6505:Pik3r5	UTSW	11	68492789	missense	probably benign	0.16
R6534:Pik3r5	UTSW	11	68490617	missense	possibly damaging	0.59
R6817:Pik3r5	UTSW	11	68486581	missense	probably damaging	1.00
R7246:Pik3r5	UTSW	11	68492943	missense	probably benign	0.01
R7459:Pik3r5	UTSW	11	68492590	missense	probably benign	0.03
R7527:Pik3r5	UTSW	11	68476351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTCTGCTTGAAAAGCACCTCAG -3'
(R):5'- TCTCCCAGTTTGCAGTACCAGACC -3'

Sequencing Primer
(F):5'- TGCTTGAAAAGCACCTCAGAATAATC -3'
(R):5'- TTTGCAGTACCAGACCAAGGG -3'

Posted On

2013-05-09