Incidental Mutation 'R0105:Pik3r5'
ID33276
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0105 (G1)
Quality Score173
Status Validated (trace)
Chromosome11
Chromosomal Location68432121-68497849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68490511 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 174 (E174D)
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
Predicted Effect probably damaging
Transcript: ENSMUST00000021283
AA Change: E174D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: E174D

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68496194 missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68494547 missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68496001 missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68486626 splice site probably null
IGL01623:Pik3r5 APN 11 68486626 splice site probably null
IGL01878:Pik3r5 APN 11 68492530 missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68494171 missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68490855 missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68492726 missense probably benign 0.03
palmetto UTSW 11 68494233 missense probably damaging 1.00
Palmito UTSW 11 68492000 missense probably damaging 1.00
palms UTSW 11 68486622 critical splice donor site probably null
piranha UTSW 11 68486581 missense probably damaging 1.00
Serenoa_repens UTSW 11 68475424 nonsense probably null
IGL02799:Pik3r5 UTSW 11 68495947 missense probably damaging 0.98
R0077:Pik3r5 UTSW 11 68486622 critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68492803 missense probably benign
R0118:Pik3r5 UTSW 11 68490480 missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68494224 missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68494177 missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68492492 missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68493577 missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68492917 missense probably damaging 1.00
R4588:Pik3r5 UTSW 11 68493261 intron probably benign
R4716:Pik3r5 UTSW 11 68495204 missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68493638 missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68491964 missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68477468 missense possibly damaging 0.86
R5528:Pik3r5 UTSW 11 68495977 missense probably damaging 1.00
R5554:Pik3r5 UTSW 11 68494233 missense probably damaging 1.00
R5693:Pik3r5 UTSW 11 68494251 missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68492270 missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68492318 missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68492675 missense probably benign
R6243:Pik3r5 UTSW 11 68492000 missense probably damaging 1.00
R6322:Pik3r5 UTSW 11 68492741 missense probably benign
R6420:Pik3r5 UTSW 11 68475424 nonsense probably null
R6505:Pik3r5 UTSW 11 68492789 missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68490617 missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68486581 missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68492943 missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68492590 missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68476351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTCTGCTTGAAAAGCACCTCAG -3'
(R):5'- TCTCCCAGTTTGCAGTACCAGACC -3'

Sequencing Primer
(F):5'- TGCTTGAAAAGCACCTCAGAATAATC -3'
(R):5'- TTTGCAGTACCAGACCAAGGG -3'
Posted On2013-05-09