Incidental Mutation 'R3411:Pdzd8'
ID332768
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3411 (G1)
Quality Score77
Status Validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59345413 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 59 (Y59H)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: Y59H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: Y59H

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.2427 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGATCTTCTTGGTGACCCAG -3'
(R):5'- GCGACCGATGTCCTCAAGAT -3'

Sequencing Primer
(F):5'- TTGGTGACCCAGCGGCG -3'
(R):5'- CTCAAGATGGAGGCGGC -3'
Posted On2015-08-17