Incidental Mutation 'R4514:Pask'
ID332771
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene NamePAS domain containing serine/threonine kinase
SynonymsPaskin
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93308770-93343482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93322133 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 515 (Q515L)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027493]
Predicted Effect probably benign
Transcript: ENSMUST00000027493
AA Change: Q515L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: Q515L

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93310852 missense probably benign 0.02
IGL01620:Pask APN 1 93310122 missense possibly damaging 0.87
IGL01959:Pask APN 1 93334607 missense probably benign 0.03
IGL02170:Pask APN 1 93310884 missense possibly damaging 0.69
IGL02499:Pask APN 1 93321095 nonsense probably null
IGL02670:Pask APN 1 93310818 missense probably damaging 1.00
IGL03066:Pask APN 1 93330866 missense probably benign 0.02
IGL03210:Pask APN 1 93319992 missense possibly damaging 0.92
R0472:Pask UTSW 1 93320917 missense probably benign 0.00
R0524:Pask UTSW 1 93310834 missense probably damaging 1.00
R0854:Pask UTSW 1 93327400 missense probably damaging 0.99
R0854:Pask UTSW 1 93327412 missense probably damaging 1.00
R0854:Pask UTSW 1 93327434 missense possibly damaging 0.79
R0863:Pask UTSW 1 93314339 missense probably damaging 1.00
R1052:Pask UTSW 1 93330827 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1831:Pask UTSW 1 93320769 splice site probably null
R1958:Pask UTSW 1 93321458 missense probably benign 0.00
R2143:Pask UTSW 1 93321297 missense probably benign 0.00
R2144:Pask UTSW 1 93321297 missense probably benign 0.00
R2145:Pask UTSW 1 93321297 missense probably benign 0.00
R2509:Pask UTSW 1 93330763 missense possibly damaging 0.62
R2858:Pask UTSW 1 93321651 missense probably benign 0.00
R2899:Pask UTSW 1 93334547 missense probably damaging 1.00
R3545:Pask UTSW 1 93317115 missense probably damaging 1.00
R3778:Pask UTSW 1 93327467 missense probably damaging 1.00
R4111:Pask UTSW 1 93310818 missense probably damaging 1.00
R4527:Pask UTSW 1 93320502 missense probably benign
R4580:Pask UTSW 1 93322108 missense probably benign 0.36
R4718:Pask UTSW 1 93322196 missense possibly damaging 0.67
R4775:Pask UTSW 1 93337524 missense probably damaging 0.97
R5036:Pask UTSW 1 93322079 nonsense probably null
R5070:Pask UTSW 1 93330874 missense probably damaging 1.00
R5084:Pask UTSW 1 93322097 missense probably benign
R5151:Pask UTSW 1 93334628 missense probably damaging 1.00
R5196:Pask UTSW 1 93310083 unclassified probably benign
R5643:Pask UTSW 1 93337343 critical splice donor site probably null
R5739:Pask UTSW 1 93322056 missense probably benign
R6126:Pask UTSW 1 93314359 missense probably damaging 1.00
R7161:Pask UTSW 1 93310905 missense probably benign
R7284:Pask UTSW 1 93320669 missense probably benign 0.01
R7289:Pask UTSW 1 93331587 missense probably damaging 1.00
R8277:Pask UTSW 1 93325363 critical splice donor site probably null
R8303:Pask UTSW 1 93320564 missense probably benign 0.10
R8309:Pask UTSW 1 93312851 nonsense probably null
R8321:Pask UTSW 1 93320655 missense possibly damaging 0.85
Z1088:Pask UTSW 1 93316801 missense probably damaging 1.00
Z1177:Pask UTSW 1 93335732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCTCCTTTCCCAAGAC -3'
(R):5'- ATTTGAGACTGTCCTAAGTGTACC -3'

Sequencing Primer
(F):5'- CATGGATATGCTGGCCTGCAAAC -3'
(R):5'- GAGACTGTCCTAAGTGTACCATGTTC -3'
Posted On2015-08-18