Mutagenetix > Incidental Mutations

Incidental Mutation 'R4514:Lct'

332772

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

041588-MU

Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4514 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128284756-128328318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128300514 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1081 (I1081V)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

Predicted Effect

probably benign
Transcript: ENSMUST00000073490
AA Change: I1081V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: I1081V

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	T	G	8: 24,818,136	T51P	probably damaging	Het
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Alg9	C	T	9: 50,805,354	T409M	possibly damaging	Het
Arpp21	T	A	9: 112,177,677	T155S	probably damaging	Het
Atm	T	A	9: 53,493,039	Q1334L	probably damaging	Het
Bptf	G	A	11: 107,077,692	T1055M	probably damaging	Het
Cd3g	C	A	9: 44,973,584	A121S	possibly damaging	Het
Cenpn	A	G	8: 116,933,396	Y68C	probably damaging	Het
Clock	A	G	5: 76,230,199	I618T	probably benign	Het
Cp	A	G	3: 19,988,013	M982V	probably damaging	Het
Csf3r	T	A	4: 126,039,860	S611T	possibly damaging	Het
Csn3	A	G	5: 87,930,138	T168A	unknown	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
D630003M21Rik	T	C	2: 158,204,802	T752A	probably benign	Het
Defb34	A	T	8: 19,126,506	D71V	probably damaging	Het
Dync1h1	T	A	12: 110,657,139	D3615E	possibly damaging	Het
Etl4	A	T	2: 20,661,898	T167S	probably damaging	Het
F5	T	A	1: 164,151,997		probably benign	Het
Got1l1	C	T	8: 27,198,485	M279I	probably benign	Het
Grm7	A	G	6: 111,358,304	T559A	possibly damaging	Het
Ifit1	A	T	19: 34,648,513	R350*	probably null	Het
Ighv2-5	T	C	12: 113,685,596	N79S	possibly damaging	Het
Igkv17-127	A	G	6: 67,861,514	I70V	possibly damaging	Het
Itga8	T	C	2: 12,182,736	S711G	probably benign	Het
Kndc1	A	G	7: 139,910,286	T235A	probably benign	Het
Lrrc8b	G	T	5: 105,479,953	C55F	probably damaging	Het
Lrwd1	T	C	5: 136,131,548	T311A	probably benign	Het
Mapk14	T	C	17: 28,724,824	F129S	probably damaging	Het
Mdga2	A	G	12: 66,716,722	I200T	probably damaging	Het
Mocos	T	A	18: 24,683,212	S615R	probably damaging	Het
Myh4	T	C	11: 67,255,569	V1456A	probably benign	Het
Myh9	T	C	15: 77,764,000	I1759V	probably benign	Het
Nat8f5	G	A	6: 85,817,423	T185I	possibly damaging	Het
Nav3	T	C	10: 109,694,082	I2133V	possibly damaging	Het
Ncam2	T	A	16: 81,512,996	M458K	probably benign	Het
Nphp1	T	C	2: 127,748,087	S532G	probably benign	Het
Olfr1184	T	C	2: 88,487,365	V211A	probably benign	Het
Olfr649	C	T	7: 104,189,391	R272H	probably benign	Het
Oplah	A	G	15: 76,297,955	L1035P	probably damaging	Het
Pask	T	A	1: 93,322,133	Q515L	probably benign	Het
Poglut1	A	T	16: 38,549,416	F35I	probably benign	Het
Ppp1ca	T	G	19: 4,195,055	I319S	probably benign	Het
Psg25	T	A	7: 18,529,608	R97*	probably null	Het
Sars2	T	C	7: 28,742,284		probably null	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Slc16a7	T	G	10: 125,233,439		probably null	Het
Slc7a8	C	G	14: 54,735,790	G240A	possibly damaging	Het
St6gal2	A	T	17: 55,483,017	N351Y	probably benign	Het
Susd5	T	C	9: 114,095,924	F292L	probably benign	Het
Tmco5	T	A	2: 116,880,314	D38E	probably damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Uncx	A	G	5: 139,546,767	I196V	possibly damaging	Het
Zeb1	G	A	18: 5,759,007	C138Y	probably damaging	Het
Zfp609	A	G	9: 65,703,695	I662T	possibly damaging	Het
Zfp985	G	A	4: 147,583,563	C296Y	probably damaging	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128287556	missense	probably benign	0.09
IGL00970:Lct	APN	1	128304068	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128300859	missense	probably benign
IGL01878:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128307605	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128286590	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128303790	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128294266	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128308251	missense	probably benign	0.01
IGL02818:Lct	APN	1	128300168	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128313132	missense	probably benign	0.26
IGL02951:Lct	APN	1	128300211	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128300375	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128327689	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128308047	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0071:Lct	UTSW	1	128292018	nonsense	probably null
R0135:Lct	UTSW	1	128285123	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128327895	missense	probably benign	0.00
R0179:Lct	UTSW	1	128327685	missense	probably benign
R0331:Lct	UTSW	1	128298742	splice site	probably benign
R0366:Lct	UTSW	1	128286462	missense	probably benign	0.03
R0399:Lct	UTSW	1	128300525	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128300582	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128308234	missense	probably benign	0.00
R0755:Lct	UTSW	1	128294135	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128286609	missense	probably benign	0.00
R1128:Lct	UTSW	1	128301309	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128294124	critical splice donor site	probably null
R1321:Lct	UTSW	1	128300022	missense	probably benign
R1448:Lct	UTSW	1	128307822	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128307903	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128294195	missense	probably benign	0.25
R1582:Lct	UTSW	1	128300562	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128287722	splice site	probably null
R1757:Lct	UTSW	1	128301257	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128300301	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128327942	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128300159	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128294161	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128304121	nonsense	probably null
R3001:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128301372	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128287608	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128285181	missense	probably benign	0.00
R4226:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128304226	missense	probably damaging	1.00
R4570:Lct	UTSW	1	128299904	missense	probably benign	0.01
R4776:Lct	UTSW	1	128300387	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128308241	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128300565	missense	probably benign	0.38
R5318:Lct	UTSW	1	128304372	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128298529	missense	probably benign	0.06
R5385:Lct	UTSW	1	128311617	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128286677	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128294131	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128295232	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128300336	missense	probably benign
R6026:Lct	UTSW	1	128300018	missense	probably benign
R6044:Lct	UTSW	1	128307980	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128327714	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128304237	missense	probably benign	0.01
R6412:Lct	UTSW	1	128327718	missense	probably benign	0.00
R6480:Lct	UTSW	1	128294320	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128300478	missense	probably benign	0.05
R6620:Lct	UTSW	1	128295072	critical splice donor site	probably null
R7214:Lct	UTSW	1	128300460	missense	probably benign	0.00
R7308:Lct	UTSW	1	128319087	missense	probably benign	0.00
R7577:Lct	UTSW	1	128300732	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128285195	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128298693	missense	probably benign	0.12
R7901:Lct	UTSW	1	128288985	missense	probably benign	0.44
R8033:Lct	UTSW	1	128285259	missense	probably benign	0.03
R8373:Lct	UTSW	1	128303840	missense	probably damaging	1.00
R8504:Lct	UTSW	1	128287569	missense	probably damaging	1.00
X0052:Lct	UTSW	1	128307630	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128301320	missense	probably damaging	1.00
Z1176:Lct	UTSW	1	128287611	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTAAACTGCAGCATCCGGTC -3'
(R):5'- GACACTCTTTCACTGGGACCTG -3'

Sequencing Primer
(F):5'- TCAGCGGCTTCCACGTC -3'
(R):5'- GCTATGCGGACTTCTGTT -3'

Posted On

2015-08-18