Incidental Mutation 'R4514:Nphp1'
ID332777
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Namenephronophthisis 1 (juvenile) homolog (human)
Synonymsnephrocystin
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127740732-127788897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127748087 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 532 (S532G)
Ref Sequence ENSEMBL: ENSMUSP00000105986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]
Predicted Effect probably benign
Transcript: ENSMUST00000028857
AA Change: S533G

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: S533G

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110357
AA Change: S532G

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: S532G

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148033
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127763885 missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127763849 missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127780136 missense probably benign 0.06
IGL01893:Nphp1 APN 2 127769644 missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127780069 missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127754049 missense probably benign 0.03
IGL02340:Nphp1 APN 2 127780067 nonsense probably null
IGL02836:Nphp1 APN 2 127769623 missense probably benign 0.00
IGL03109:Nphp1 APN 2 127768169 critical splice donor site probably benign
R1632:Nphp1 UTSW 2 127770392 missense probably benign 0.32
R1857:Nphp1 UTSW 2 127770376 missense probably benign 0.00
R4425:Nphp1 UTSW 2 127788799 missense possibly damaging 0.82
R4546:Nphp1 UTSW 2 127766019 splice site probably null
R4580:Nphp1 UTSW 2 127768169 critical splice donor site probably null
R5634:Nphp1 UTSW 2 127759650 missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127753979 missense probably benign
R7326:Nphp1 UTSW 2 127761217 missense possibly damaging 0.76
R7985:Nphp1 UTSW 2 127745909 missense probably damaging 0.97
R8029:Nphp1 UTSW 2 127741116 missense probably benign 0.00
X0022:Nphp1 UTSW 2 127761214 missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127779127 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCACCCCAATGCTATTCAG -3'
(R):5'- CTCTGGTTTAAAGTGACCAAGTTGTG -3'

Sequencing Primer
(F):5'- TTCCACAGGCCACATCTGTAGG -3'
(R):5'- GAAAATCCCCCGTAGGTT -3'
Posted On2015-08-18