Mutagenetix > Incidental Mutation

Incidental Mutation 'R4514:Kndc1'

332798

Institutional Source

Beutler Lab

Gene Symbol

Kndc1

Ensembl Gene

ENSMUSG00000066129

Gene Name

kinase non-catalytic C-lobe domain (KIND) containing 1

Synonyms

B830014K08Rik, VKIND, very-kind, 2410012C07Rik

MMRRC Submission

041588-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4514 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

139474612-139521450 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139490202 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 235 (T235A)

Ref Sequence

ENSEMBL: ENSMUSP00000113856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]

AlphaFold

Q0KK55

Predicted Effect

probably benign
Transcript: ENSMUST00000053445
AA Change: T235A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: T235A

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
KIND	456	620	1.22e-50	SMART
low complexity region	658	670	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
low complexity region	792	801	N/A	INTRINSIC
low complexity region	949	965	N/A	INTRINSIC
coiled coil region	1121	1151	N/A	INTRINSIC
Pfam:RasGEF_N	1242	1341	2.2e-17	PFAM
Pfam:RasGEF	1464	1672	3.8e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121839
AA Change: T235A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: T235A

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
low complexity region	455	465	N/A	INTRINSIC
Blast:KIND	466	539	7e-32	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000151421
AA Change: T235A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116435
Gene: ENSMUSG00000066129
AA Change: T235A

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
KIND	456	620	1.22e-50	SMART
low complexity region	658	670	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
low complexity region	792	801	N/A	INTRINSIC
low complexity region	949	965	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154782

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	T	G	8: 25,308,152 (GRCm39)	T51P	probably damaging	Het
Akr1c20	A	C	13: 4,557,843 (GRCm39)	V201G	probably damaging	Het
Alg9	C	T	9: 50,716,654 (GRCm39)	T409M	possibly damaging	Het
Arpp21	T	A	9: 112,006,745 (GRCm39)	T155S	probably damaging	Het
Atm	T	A	9: 53,404,339 (GRCm39)	Q1334L	probably damaging	Het
Bptf	G	A	11: 106,968,518 (GRCm39)	T1055M	probably damaging	Het
Cd3g	C	A	9: 44,884,882 (GRCm39)	A121S	possibly damaging	Het
Cenpn	A	G	8: 117,660,135 (GRCm39)	Y68C	probably damaging	Het
Clock	A	G	5: 76,378,046 (GRCm39)	I618T	probably benign	Het
Cp	A	G	3: 20,042,177 (GRCm39)	M982V	probably damaging	Het
Csf3r	T	A	4: 125,933,653 (GRCm39)	S611T	possibly damaging	Het
Csn3	A	G	5: 88,077,997 (GRCm39)	T168A	unknown	Het
Cylc2	C	G	4: 51,229,651 (GRCm39)	T331R	unknown	Het
D630003M21Rik	T	C	2: 158,046,722 (GRCm39)	T752A	probably benign	Het
Defb34	A	T	8: 19,176,522 (GRCm39)	D71V	probably damaging	Het
Dync1h1	T	A	12: 110,623,573 (GRCm39)	D3615E	possibly damaging	Het
Etl4	A	T	2: 20,666,709 (GRCm39)	T167S	probably damaging	Het
F5	T	A	1: 163,979,566 (GRCm39)		probably benign	Het
Got1l1	C	T	8: 27,688,513 (GRCm39)	M279I	probably benign	Het
Grm7	A	G	6: 111,335,265 (GRCm39)	T559A	possibly damaging	Het
Ifit1	A	T	19: 34,625,913 (GRCm39)	R350*	probably null	Het
Ighv2-5	T	C	12: 113,649,216 (GRCm39)	N79S	possibly damaging	Het
Igkv17-127	A	G	6: 67,838,498 (GRCm39)	I70V	possibly damaging	Het
Itga8	T	C	2: 12,187,547 (GRCm39)	S711G	probably benign	Het
Lct	T	C	1: 128,228,251 (GRCm39)	I1081V	probably benign	Het
Lrrc8b	G	T	5: 105,627,819 (GRCm39)	C55F	probably damaging	Het
Lrwd1	T	C	5: 136,160,402 (GRCm39)	T311A	probably benign	Het
Mapk14	T	C	17: 28,943,798 (GRCm39)	F129S	probably damaging	Het
Mdga2	A	G	12: 66,763,496 (GRCm39)	I200T	probably damaging	Het
Mocos	T	A	18: 24,816,269 (GRCm39)	S615R	probably damaging	Het
Myh4	T	C	11: 67,146,395 (GRCm39)	V1456A	probably benign	Het
Myh9	T	C	15: 77,648,200 (GRCm39)	I1759V	probably benign	Het
Nat8f5	G	A	6: 85,794,405 (GRCm39)	T185I	possibly damaging	Het
Nav3	T	C	10: 109,529,943 (GRCm39)	I2133V	possibly damaging	Het
Ncam2	T	A	16: 81,309,884 (GRCm39)	M458K	probably benign	Het
Nphp1	T	C	2: 127,590,007 (GRCm39)	S532G	probably benign	Het
Oplah	A	G	15: 76,182,155 (GRCm39)	L1035P	probably damaging	Het
Or4p22	T	C	2: 88,317,709 (GRCm39)	V211A	probably benign	Het
Or52h2	C	T	7: 103,838,598 (GRCm39)	R272H	probably benign	Het
Pask	T	A	1: 93,249,855 (GRCm39)	Q515L	probably benign	Het
Poglut1	A	T	16: 38,369,778 (GRCm39)	F35I	probably benign	Het
Ppp1ca	T	G	19: 4,245,054 (GRCm39)	I319S	probably benign	Het
Psg25	T	A	7: 18,263,533 (GRCm39)	R97*	probably null	Het
Sars2	T	C	7: 28,441,709 (GRCm39)		probably null	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Slc16a7	T	G	10: 125,069,308 (GRCm39)		probably null	Het
Slc7a8	C	G	14: 54,973,247 (GRCm39)	G240A	possibly damaging	Het
St6gal2	A	T	17: 55,790,018 (GRCm39)	N351Y	probably benign	Het
Susd5	T	C	9: 113,924,992 (GRCm39)	F292L	probably benign	Het
Tmco5	T	A	2: 116,710,795 (GRCm39)	D38E	probably damaging	Het
Tubgcp2	G	A	7: 139,575,984 (GRCm39)	P893L	possibly damaging	Het
Uncx	A	G	5: 139,532,522 (GRCm39)	I196V	possibly damaging	Het
Zeb1	G	A	18: 5,759,007 (GRCm39)	C138Y	probably damaging	Het
Zfp609	A	G	9: 65,610,977 (GRCm39)	I662T	possibly damaging	Het
Zfp985	G	A	4: 147,668,020 (GRCm39)	C296Y	probably damaging	Het

Other mutations in Kndc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Kndc1	APN	7	139,481,904 (GRCm39)	splice site	probably benign
IGL01061:Kndc1	APN	7	139,502,610 (GRCm39)	missense	probably benign	0.00
IGL01099:Kndc1	APN	7	139,500,700 (GRCm39)	missense	probably damaging	1.00
IGL01522:Kndc1	APN	7	139,493,888 (GRCm39)	splice site	probably benign
IGL01767:Kndc1	APN	7	139,509,959 (GRCm39)	missense	probably damaging	1.00
IGL01884:Kndc1	APN	7	139,494,110 (GRCm39)	missense	probably damaging	1.00
IGL01932:Kndc1	APN	7	139,503,705 (GRCm39)	missense	probably damaging	0.98
IGL02133:Kndc1	APN	7	139,500,683 (GRCm39)	missense	probably benign	0.19
IGL02411:Kndc1	APN	7	139,501,829 (GRCm39)	critical splice donor site	probably null
IGL02472:Kndc1	APN	7	139,490,817 (GRCm39)	missense	probably benign	0.01
IGL02537:Kndc1	APN	7	139,490,326 (GRCm39)	missense	probably benign	0.01
IGL02708:Kndc1	APN	7	139,481,097 (GRCm39)	missense	probably damaging	1.00
IGL03115:Kndc1	APN	7	139,501,425 (GRCm39)	missense	probably benign	0.28
IGL03160:Kndc1	APN	7	139,500,605 (GRCm39)	nonsense	probably null
IGL03138:Kndc1	UTSW	7	139,519,791 (GRCm39)	missense	possibly damaging	0.89
PIT4142001:Kndc1	UTSW	7	139,503,692 (GRCm39)	frame shift	probably null
PIT4696001:Kndc1	UTSW	7	139,512,830 (GRCm39)	missense	probably damaging	1.00
R0349:Kndc1	UTSW	7	139,490,220 (GRCm39)	missense	probably benign	0.00
R0384:Kndc1	UTSW	7	139,490,515 (GRCm39)	missense	possibly damaging	0.85
R0415:Kndc1	UTSW	7	139,510,037 (GRCm39)	missense	probably damaging	1.00
R0421:Kndc1	UTSW	7	139,488,912 (GRCm39)	missense	probably damaging	1.00
R0487:Kndc1	UTSW	7	139,493,939 (GRCm39)	missense	probably null	0.19
R0530:Kndc1	UTSW	7	139,481,153 (GRCm39)	missense	probably damaging	1.00
R0905:Kndc1	UTSW	7	139,503,651 (GRCm39)	missense	possibly damaging	0.94
R1434:Kndc1	UTSW	7	139,502,600 (GRCm39)	missense	probably damaging	1.00
R1608:Kndc1	UTSW	7	139,507,321 (GRCm39)	missense	possibly damaging	0.80
R1644:Kndc1	UTSW	7	139,510,669 (GRCm39)	missense	probably damaging	1.00
R1835:Kndc1	UTSW	7	139,507,624 (GRCm39)	missense	probably damaging	0.99
R2012:Kndc1	UTSW	7	139,501,196 (GRCm39)	missense	possibly damaging	0.90
R2102:Kndc1	UTSW	7	139,510,674 (GRCm39)	missense	probably benign	0.02
R2103:Kndc1	UTSW	7	139,501,150 (GRCm39)	missense	probably benign	0.01
R2128:Kndc1	UTSW	7	139,510,025 (GRCm39)	missense	probably damaging	1.00
R2516:Kndc1	UTSW	7	139,501,738 (GRCm39)	missense	probably damaging	1.00
R3030:Kndc1	UTSW	7	139,481,123 (GRCm39)	missense	probably damaging	1.00
R3617:Kndc1	UTSW	7	139,481,976 (GRCm39)	splice site	probably benign
R3747:Kndc1	UTSW	7	139,507,817 (GRCm39)	critical splice donor site	probably null
R3848:Kndc1	UTSW	7	139,488,893 (GRCm39)	missense	probably damaging	1.00
R4028:Kndc1	UTSW	7	139,509,941 (GRCm39)	missense	probably damaging	0.98
R4043:Kndc1	UTSW	7	139,504,044 (GRCm39)	missense	probably benign	0.06
R4044:Kndc1	UTSW	7	139,504,044 (GRCm39)	missense	probably benign	0.06
R4095:Kndc1	UTSW	7	139,516,938 (GRCm39)	missense	possibly damaging	0.49
R4289:Kndc1	UTSW	7	139,490,798 (GRCm39)	missense	probably benign	0.01
R4478:Kndc1	UTSW	7	139,500,600 (GRCm39)	missense	probably damaging	1.00
R4540:Kndc1	UTSW	7	139,501,343 (GRCm39)	nonsense	probably null
R4584:Kndc1	UTSW	7	139,481,159 (GRCm39)	missense	probably damaging	1.00
R4693:Kndc1	UTSW	7	139,501,695 (GRCm39)	missense	probably benign	0.02
R4705:Kndc1	UTSW	7	139,510,036 (GRCm39)	missense	possibly damaging	0.81
R4773:Kndc1	UTSW	7	139,503,946 (GRCm39)	nonsense	probably null
R4859:Kndc1	UTSW	7	139,501,821 (GRCm39)	missense	probably benign	0.03
R5004:Kndc1	UTSW	7	139,512,792 (GRCm39)	nonsense	probably null
R5037:Kndc1	UTSW	7	139,490,371 (GRCm39)	missense	possibly damaging	0.52
R5322:Kndc1	UTSW	7	139,516,722 (GRCm39)	missense	probably damaging	1.00
R5428:Kndc1	UTSW	7	139,488,878 (GRCm39)	missense	probably damaging	0.99
R5503:Kndc1	UTSW	7	139,511,802 (GRCm39)	missense	probably damaging	1.00
R5506:Kndc1	UTSW	7	139,507,804 (GRCm39)	missense	probably damaging	1.00
R5525:Kndc1	UTSW	7	139,504,026 (GRCm39)	missense	probably benign	0.00
R5888:Kndc1	UTSW	7	139,475,133 (GRCm39)	missense	probably benign	0.00
R5942:Kndc1	UTSW	7	139,516,792 (GRCm39)	missense	probably damaging	1.00
R5979:Kndc1	UTSW	7	139,519,740 (GRCm39)	missense	probably benign	0.05
R5990:Kndc1	UTSW	7	139,507,333 (GRCm39)	missense	probably damaging	0.99
R6038:Kndc1	UTSW	7	139,503,691 (GRCm39)	frame shift	probably null
R6076:Kndc1	UTSW	7	139,481,954 (GRCm39)	missense	probably damaging	1.00
R6118:Kndc1	UTSW	7	139,503,717 (GRCm39)	missense	probably damaging	1.00
R6151:Kndc1	UTSW	7	139,501,129 (GRCm39)	missense	probably benign	0.04
R6276:Kndc1	UTSW	7	139,500,979 (GRCm39)	missense	probably benign
R6367:Kndc1	UTSW	7	139,493,422 (GRCm39)	missense	probably damaging	1.00
R6726:Kndc1	UTSW	7	139,502,667 (GRCm39)	critical splice donor site	probably null
R6745:Kndc1	UTSW	7	139,500,892 (GRCm39)	missense	probably benign	0.02
R6886:Kndc1	UTSW	7	139,493,485 (GRCm39)	missense	probably benign	0.01
R6912:Kndc1	UTSW	7	139,490,194 (GRCm39)	missense	probably damaging	0.99
R7070:Kndc1	UTSW	7	139,501,744 (GRCm39)	missense	probably damaging	1.00
R7123:Kndc1	UTSW	7	139,516,749 (GRCm39)	missense	probably damaging	0.99
R7158:Kndc1	UTSW	7	139,511,773 (GRCm39)	missense	possibly damaging	0.48
R7248:Kndc1	UTSW	7	139,500,699 (GRCm39)	missense	probably damaging	1.00
R7437:Kndc1	UTSW	7	139,488,959 (GRCm39)	missense	probably damaging	1.00
R7564:Kndc1	UTSW	7	139,500,612 (GRCm39)	missense	probably benign	0.01
R7570:Kndc1	UTSW	7	139,503,691 (GRCm39)	frame shift	probably null
R7625:Kndc1	UTSW	7	139,517,930 (GRCm39)	missense	possibly damaging	0.90
R7629:Kndc1	UTSW	7	139,475,176 (GRCm39)	missense	probably damaging	1.00
R7726:Kndc1	UTSW	7	139,519,751 (GRCm39)	missense	possibly damaging	0.67
R7840:Kndc1	UTSW	7	139,503,731 (GRCm39)	missense	probably damaging	1.00
R7859:Kndc1	UTSW	7	139,500,880 (GRCm39)	missense	possibly damaging	0.57
R7934:Kndc1	UTSW	7	139,501,402 (GRCm39)	missense	probably benign	0.02
R8011:Kndc1	UTSW	7	139,490,536 (GRCm39)	missense	possibly damaging	0.90
R8062:Kndc1	UTSW	7	139,498,760 (GRCm39)	missense	probably benign	0.01
R8134:Kndc1	UTSW	7	139,481,285 (GRCm39)	splice site	probably null
R8197:Kndc1	UTSW	7	139,493,447 (GRCm39)	missense	probably damaging	1.00
R8350:Kndc1	UTSW	7	139,503,960 (GRCm39)	missense	probably damaging	1.00
R8399:Kndc1	UTSW	7	139,493,434 (GRCm39)	missense	probably damaging	1.00
R8400:Kndc1	UTSW	7	139,493,434 (GRCm39)	missense	probably damaging	1.00
R8447:Kndc1	UTSW	7	139,481,121 (GRCm39)	missense	probably damaging	1.00
R8534:Kndc1	UTSW	7	139,503,669 (GRCm39)	missense	probably benign	0.27
R8735:Kndc1	UTSW	7	139,490,130 (GRCm39)	missense	probably benign	0.00
R8816:Kndc1	UTSW	7	139,517,909 (GRCm39)	missense	probably damaging	1.00
R8883:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R8899:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R8961:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R8961:Kndc1	UTSW	7	139,503,976 (GRCm39)	missense	possibly damaging	0.95
R9002:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9010:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9065:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9066:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9223:Kndc1	UTSW	7	139,501,357 (GRCm39)	missense	possibly damaging	0.89
R9230:Kndc1	UTSW	7	139,500,600 (GRCm39)	missense	probably damaging	1.00
R9291:Kndc1	UTSW	7	139,475,140 (GRCm39)	missense	possibly damaging	0.55
R9441:Kndc1	UTSW	7	139,501,392 (GRCm39)	missense	probably damaging	0.99
R9476:Kndc1	UTSW	7	139,510,031 (GRCm39)	missense	probably benign	0.00
R9510:Kndc1	UTSW	7	139,510,031 (GRCm39)	missense	probably benign	0.00
R9518:Kndc1	UTSW	7	139,519,827 (GRCm39)	missense	probably damaging	1.00
R9758:Kndc1	UTSW	7	139,500,620 (GRCm39)	missense	possibly damaging	0.71
Z1177:Kndc1	UTSW	7	139,501,828 (GRCm39)	missense	possibly damaging	0.63
Z1186:Kndc1	UTSW	7	139,490,729 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTATGCTAAGGGGTGGATG -3'
(R):5'- TGAGGTTGTCTCTGTCCAGC -3'

Sequencing Primer
(F):5'- ACTCTGGGAGTGCAGGAC -3'
(R):5'- TCTGTCCAGCTCGCCCAG -3'

Posted On

2015-08-18