Incidental Mutation 'R4514:Tubgcp2'
ID332799
Institutional Source Beutler Lab
Gene Symbol Tubgcp2
Ensembl Gene ENSMUSG00000025474
Gene Nametubulin, gamma complex associated protein 2
Synonyms1700022B05Rik
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139995955-140036669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139996071 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 893 (P893L)
Ref Sequence ENSEMBL: ENSMUSP00000026547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000026547] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209] [ENSMUST00000210224] [ENSMUST00000211638]
Predicted Effect probably benign
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000026547
AA Change: P893L

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026547
Gene: ENSMUSG00000025474
AA Change: P893L

DomainStartEndE-ValueType
low complexity region 109 121 N/A INTRINSIC
Pfam:Spc97_Spc98 220 738 8.6e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect probably benign
Transcript: ENSMUST00000148670
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209930
Predicted Effect probably benign
Transcript: ENSMUST00000210224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211186
Predicted Effect probably benign
Transcript: ENSMUST00000211638
AA Change: P893L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Tubgcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tubgcp2 APN 7 140031022 missense possibly damaging 0.58
IGL00791:Tubgcp2 APN 7 140001498 missense probably damaging 0.97
IGL02643:Tubgcp2 APN 7 139996154 missense probably damaging 1.00
IGL02710:Tubgcp2 APN 7 140004984 splice site probably benign
IGL03352:Tubgcp2 APN 7 140001027 missense probably benign 0.01
R0189:Tubgcp2 UTSW 7 140001605 splice site probably benign
R0333:Tubgcp2 UTSW 7 139999347 missense probably damaging 1.00
R0379:Tubgcp2 UTSW 7 140032192 missense probably damaging 1.00
R1051:Tubgcp2 UTSW 7 139998896 missense probably benign 0.26
R1192:Tubgcp2 UTSW 7 140029838 missense probably benign
R1528:Tubgcp2 UTSW 7 140033783 unclassified probably benign
R1728:Tubgcp2 UTSW 7 139998055 missense probably benign
R1729:Tubgcp2 UTSW 7 139998055 missense probably benign
R1784:Tubgcp2 UTSW 7 139998055 missense probably benign
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1967:Tubgcp2 UTSW 7 140006153 missense probably benign 0.09
R4545:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4774:Tubgcp2 UTSW 7 139996161 missense probably damaging 1.00
R4790:Tubgcp2 UTSW 7 139999288 missense probably damaging 1.00
R5114:Tubgcp2 UTSW 7 140007441 missense possibly damaging 0.91
R5435:Tubgcp2 UTSW 7 139996072 missense possibly damaging 0.51
R5531:Tubgcp2 UTSW 7 140005024 splice site probably null
R5699:Tubgcp2 UTSW 7 139998788 missense possibly damaging 0.53
R5706:Tubgcp2 UTSW 7 140032225 nonsense probably null
R6123:Tubgcp2 UTSW 7 140007597 missense probably damaging 1.00
R7153:Tubgcp2 UTSW 7 140001036 missense probably benign
R7165:Tubgcp2 UTSW 7 140005361 missense probably damaging 0.99
R7213:Tubgcp2 UTSW 7 140008014 missense probably benign 0.28
R7424:Tubgcp2 UTSW 7 140007924 missense possibly damaging 0.65
R7511:Tubgcp2 UTSW 7 140004880 missense probably benign 0.00
R7523:Tubgcp2 UTSW 7 140006870 missense probably benign 0.08
R7612:Tubgcp2 UTSW 7 140001051 missense probably damaging 1.00
R7951:Tubgcp2 UTSW 7 140007980 missense possibly damaging 0.69
R8220:Tubgcp2 UTSW 7 140006140 missense possibly damaging 0.92
X0004:Tubgcp2 UTSW 7 140007021 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGAAAAGCTTCTAAAAGGAAGTC -3'
(R):5'- CCCTGGTTGAACCTGTCACATG -3'

Sequencing Primer
(F):5'- AAGCTTCTAAAAGGAAGTCTAACATC -3'
(R):5'- CCTGTCACATGATTGGGAGAC -3'
Posted On2015-08-18