Incidental Mutation 'R4514:Oplah'
ID332818
Institutional Source Beutler Lab
Gene Symbol Oplah
Ensembl Gene ENSMUSG00000022562
Gene Name5-oxoprolinase (ATP-hydrolysing)
Synonyms
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76296601-76328015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76297955 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1035 (L1035P)
Ref Sequence ENSEMBL: ENSMUSP00000129100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023222] [ENSMUST00000163991] [ENSMUST00000164189] [ENSMUST00000171192] [ENSMUST00000171340]
Predicted Effect probably damaging
Transcript: ENSMUST00000023222
AA Change: L1035P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023222
Gene: ENSMUSG00000022562
AA Change: L1035P

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 1.5e-63 PFAM
Pfam:Hydantoinase_A 231 531 6.4e-109 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 734 1256 5.2e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163977
Predicted Effect probably benign
Transcript: ENSMUST00000163991
SMART Domains Protein: ENSMUSP00000134687
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Exo_endo_phos 176 471 4.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164189
SMART Domains Protein: ENSMUSP00000131967
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 9.8e-61 PFAM
Pfam:Hydantoinase_A 231 531 6.9e-103 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 853 2.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170261
Predicted Effect probably benign
Transcript: ENSMUST00000171192
SMART Domains Protein: ENSMUSP00000133693
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171340
AA Change: L1035P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129100
Gene: ENSMUSG00000022562
AA Change: L1035P

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 2.8e-60 PFAM
Pfam:Hydantoinase_A 231 531 6.6e-102 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 1260 8.2e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230735
Meta Mutation Damage Score 0.6600 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homodimer, using ATP hydrolysis to catalyze the conversion of 5-oxo-L-proline to L-glutamate. Defects in this gene are a cause of 5-oxoprolinase deficiency (OPLAHD). [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Oplah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Oplah APN 15 76305748 missense probably damaging 1.00
IGL01132:Oplah APN 15 76300957 missense probably benign 0.28
IGL02252:Oplah APN 15 76304764 missense probably damaging 1.00
IGL02493:Oplah APN 15 76300955 nonsense probably null
R0033:Oplah UTSW 15 76297134 missense probably benign 0.03
R0418:Oplah UTSW 15 76298487 missense probably benign 0.06
R0609:Oplah UTSW 15 76302992 missense probably benign 0.00
R1374:Oplah UTSW 15 76306555 missense probably damaging 0.99
R1419:Oplah UTSW 15 76297920 missense probably benign 0.41
R1703:Oplah UTSW 15 76296667 missense probably benign 0.02
R1733:Oplah UTSW 15 76302483 nonsense probably null
R1959:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1960:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1961:Oplah UTSW 15 76297464 missense probably damaging 1.00
R2290:Oplah UTSW 15 76302725 missense probably benign 0.00
R3552:Oplah UTSW 15 76302094 missense possibly damaging 0.78
R4019:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4020:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4207:Oplah UTSW 15 76302710 missense probably damaging 1.00
R4512:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4525:Oplah UTSW 15 76305509 missense probably damaging 1.00
R4803:Oplah UTSW 15 76302768 missense probably damaging 1.00
R5042:Oplah UTSW 15 76305709 nonsense probably null
R5259:Oplah UTSW 15 76301210 splice site probably null
R5284:Oplah UTSW 15 76306559 missense probably benign 0.00
R5503:Oplah UTSW 15 76305446 critical splice donor site probably null
R5511:Oplah UTSW 15 76305744 missense possibly damaging 0.74
R5549:Oplah UTSW 15 76298266 missense probably damaging 0.98
R5594:Oplah UTSW 15 76296637 makesense probably null
R5631:Oplah UTSW 15 76305241 missense probably benign 0.01
R5849:Oplah UTSW 15 76297347 unclassified probably benign
R6776:Oplah UTSW 15 76300853 missense possibly damaging 0.94
R7105:Oplah UTSW 15 76297687 missense probably damaging 1.00
R7146:Oplah UTSW 15 76302660 missense probably benign
R7267:Oplah UTSW 15 76305009 missense probably benign 0.00
R7403:Oplah UTSW 15 76305009 missense probably benign 0.00
R7786:Oplah UTSW 15 76309716 missense possibly damaging 0.93
R8029:Oplah UTSW 15 76305696 missense probably benign
R8054:Oplah UTSW 15 76306257 missense probably benign 0.00
R8202:Oplah UTSW 15 76302469 missense probably benign 0.22
X0065:Oplah UTSW 15 76305163 nonsense probably null
Z1177:Oplah UTSW 15 76298487 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCCTGGTGAAATGACCAAG -3'
(R):5'- TGCCTGCATGTTCAGATCAAC -3'

Sequencing Primer
(F):5'- CCAAGGTGGTTAATTAGGGCTG -3'
(R):5'- CCTGAATCAGGTTCGCTTGTGAG -3'
Posted On2015-08-18