Incidental Mutation 'R4514:Poglut1'
ID332820
Institutional Source Beutler Lab
Gene Symbol Poglut1
Ensembl Gene ENSMUSG00000034064
Gene Nameprotein O-glucosyltransferase 1
SynonymsRumi, Ktelc1, 9630046K23Rik
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location38525137-38550258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38549416 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 35 (F35I)
Ref Sequence ENSEMBL: ENSMUSP00000038166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036210]
Predicted Effect probably benign
Transcript: ENSMUST00000036210
AA Change: F35I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064
AA Change: F35I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CAP10 121 373 6.69e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153187
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality during organogenesis, embryonic growth retardation, caudal body truncation, and severe defects in neural tube development, somitogenesis, cardiogenesis, and vascular remodeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Poglut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Poglut1 APN 16 38542916 missense possibly damaging 0.96
R0646:Poglut1 UTSW 16 38529475 missense probably damaging 0.99
R0799:Poglut1 UTSW 16 38534721 splice site probably null
R2025:Poglut1 UTSW 16 38537905 critical splice donor site probably null
R2054:Poglut1 UTSW 16 38534807 missense probably damaging 1.00
R4770:Poglut1 UTSW 16 38534757 missense probably damaging 1.00
R5649:Poglut1 UTSW 16 38531811 missense probably damaging 0.99
R5893:Poglut1 UTSW 16 38529595 missense probably damaging 0.99
R6796:Poglut1 UTSW 16 38529610 missense probably damaging 1.00
R7404:Poglut1 UTSW 16 38537922 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATTTCCATACATTACGAGAGCC -3'
(R):5'- TTGACTCAAGCCCCGACAAG -3'

Sequencing Primer
(F):5'- GGTCTCAAGACATGCTTAGATCAC -3'
(R):5'- CGACAAGTTACACAAAGAATCGTTC -3'
Posted On2015-08-18