Incidental Mutation 'R4514:Mapk14'
ID332822
Institutional Source Beutler Lab
Gene Symbol Mapk14
Ensembl Gene ENSMUSG00000053436
Gene Namemitogen-activated protein kinase 14
Synonymsp38MAPK, CSBP2, p38 alpha, p38a, Mxi2, p38 MAP kinase alpha, p38 MAP Kinase, p38alpha, p38-alpha, p38, Csbp1, Crk1, p38 MAPK
MMRRC Submission 041588-MU
Accession Numbers

Genbank: NM_011951; MGI: 1346865

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28691342-28748404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28724824 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 129 (F129S)
Ref Sequence ENSEMBL: ENSMUSP00000116914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004990] [ENSMUST00000062694] [ENSMUST00000114752] [ENSMUST00000114754] [ENSMUST00000114758] [ENSMUST00000124886]
Predicted Effect probably damaging
Transcript: ENSMUST00000004990
AA Change: F129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004990
Gene: ENSMUSG00000053436
AA Change: F129S

DomainStartEndE-ValueType
S_TKc 24 308 3.46e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062694
AA Change: F129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061958
Gene: ENSMUSG00000053436
AA Change: F129S

DomainStartEndE-ValueType
S_TKc 24 308 7.42e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114752
AA Change: F52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110400
Gene: ENSMUSG00000053436
AA Change: F52S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 193 7.3e-22 PFAM
Pfam:Pkinase 1 231 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114754
AA Change: F52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110402
Gene: ENSMUSG00000053436
AA Change: F52S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 193 7.3e-22 PFAM
Pfam:Pkinase 1 231 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114758
AA Change: F129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110406
Gene: ENSMUSG00000053436
AA Change: F129S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 242 3.8e-32 PFAM
Pfam:Pkinase 24 257 9.4e-65 PFAM
Pfam:Kdo 40 181 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124886
AA Change: F129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116914
Gene: ENSMUSG00000053436
AA Change: F129S

DomainStartEndE-ValueType
Pfam:Pkinase 24 203 3.9e-50 PFAM
Pfam:Pkinase_Tyr 24 203 1.9e-25 PFAM
Pfam:Kdo 39 181 3.9e-7 PFAM
Meta Mutation Damage Score 0.9250 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for various null mutations are embryonic to perinatal lethal showing multiple organ system defects. Mice homozygous for a knock-out mutation exhibit abnormal myoblast differentiation and delayed myofiber growth and maturation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, knock-out(4) Targeted, other(9) Gene trapped(7)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Mapk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Mapk14 APN 17 28725846 critical splice donor site probably null
IGL03013:Mapk14 APN 17 28728349 splice site probably benign
Wanzhou UTSW 17 28724824 missense probably damaging 1.00
D4043:Mapk14 UTSW 17 28745150 missense probably damaging 1.00
R0418:Mapk14 UTSW 17 28691789 missense probably benign
R4513:Mapk14 UTSW 17 28724824 missense probably damaging 1.00
R4674:Mapk14 UTSW 17 28745022 splice site probably null
R4981:Mapk14 UTSW 17 28741791 missense probably damaging 1.00
R5418:Mapk14 UTSW 17 28741843 missense possibly damaging 0.65
R7477:Mapk14 UTSW 17 28745078 missense probably damaging 0.99
R7792:Mapk14 UTSW 17 28746297 missense probably damaging 0.99
R7915:Mapk14 UTSW 17 28728954 missense probably benign 0.00
R8208:Mapk14 UTSW 17 28724833 missense probably damaging 1.00
R8241:Mapk14 UTSW 17 28715400 missense possibly damaging 0.89
R8407:Mapk14 UTSW 17 28745009 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGCTGGTGTGGTACTTC -3'
(R):5'- ACCAGGTTGTATCAGGATGC -3'

Sequencing Primer
(F):5'- GGTACTTCTTAGGCAGTCTTTCCTG -3'
(R):5'- CCAGGTTGTATCAGGATGCTACTAAC -3'
Posted On2015-08-18