Incidental Mutation 'R4514:Ppp1ca'
ID332826
Institutional Source Beutler Lab
Gene Symbol Ppp1ca
Ensembl Gene ENSMUSG00000040385
Gene Nameprotein phosphatase 1, catalytic subunit, alpha isoform
Synonymsdism2, Ppp1c
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4192158-4195419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4195055 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 319 (I319S)
Ref Sequence ENSEMBL: ENSMUSP00000039109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000045864] [ENSMUST00000046094]
Predicted Effect probably benign
Transcript: ENSMUST00000025740
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045864
SMART Domains Protein: ENSMUSP00000042660
Gene: ENSMUSG00000040247

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
TBC 87 301 7.1e-61 SMART
low complexity region 393 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046094
AA Change: I319S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385
AA Change: I319S

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Ppp1ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ppp1ca APN 19 4193144 missense probably benign 0.25
IGL00834:Ppp1ca APN 19 4194520 missense probably benign 0.20
IGL01017:Ppp1ca APN 19 4193111 missense probably damaging 0.96
IGL02150:Ppp1ca APN 19 4194699 splice site probably benign
IGL02295:Ppp1ca APN 19 4194482 nonsense probably null
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R0022:Ppp1ca UTSW 19 4194581 missense possibly damaging 0.51
R2680:Ppp1ca UTSW 19 4194595 missense possibly damaging 0.81
R3978:Ppp1ca UTSW 19 4192254 missense probably benign 0.05
R5131:Ppp1ca UTSW 19 4194896 missense probably damaging 1.00
R7606:Ppp1ca UTSW 19 4193089 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACAATGCTGGTGCCATG -3'
(R):5'- CCTGGGAGATTAGATGCTGC -3'

Sequencing Primer
(F):5'- CATGATGAGTGTGGATGAGACCCTC -3'
(R):5'- CCTGGGAGATTAGATGCTGCTATTG -3'
Posted On2015-08-18