Incidental Mutation 'R4515:Ugt1a10'
ID 332828
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene Name UDP glycosyltransferase 1 family, polypeptide A10
Synonyms A13
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 87983110-88146726 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87983919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 239 (V239E)
Ref Sequence ENSEMBL: ENSMUSP00000108767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000173325]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113142
AA Change: V239E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: V239E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 87,983,709 (GRCm39) missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 87,983,780 (GRCm39) missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 87,983,585 (GRCm39) missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 87,983,601 (GRCm39) missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
R0201:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88,145,971 (GRCm39) missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 87,983,817 (GRCm39) missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 87,983,904 (GRCm39) missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 87,983,904 (GRCm39) missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 87,983,331 (GRCm39) missense probably benign
R1207:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88,143,982 (GRCm39) missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 87,983,433 (GRCm39) missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 87,983,769 (GRCm39) missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 87,983,769 (GRCm39) missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 87,983,703 (GRCm39) missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 87,983,669 (GRCm39) missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 87,983,932 (GRCm39) missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 87,983,717 (GRCm39) missense probably benign
R4474:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4476:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4579:Ugt1a10 UTSW 1 87,983,838 (GRCm39) missense probably benign
R4582:Ugt1a10 UTSW 1 87,983,463 (GRCm39) missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 87,983,204 (GRCm39) start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88,146,112 (GRCm39) missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 87,984,009 (GRCm39) missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88,143,650 (GRCm39) intron probably benign
R4910:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 87,983,646 (GRCm39) missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 87,983,974 (GRCm39) splice site probably null
R5168:Ugt1a10 UTSW 1 87,983,531 (GRCm39) missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 87,983,632 (GRCm39) missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 87,983,632 (GRCm39) missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
R6498:Ugt1a10 UTSW 1 88,143,862 (GRCm39) missense probably damaging 1.00
R6727:Ugt1a10 UTSW 1 87,983,979 (GRCm39) splice site probably null
R6809:Ugt1a10 UTSW 1 87,983,647 (GRCm39) missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 87,983,379 (GRCm39) missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88,142,845 (GRCm39) missense probably damaging 1.00
R7913:Ugt1a10 UTSW 1 87,983,477 (GRCm39) missense probably benign 0.00
R9165:Ugt1a10 UTSW 1 87,983,509 (GRCm39) missense probably benign 0.00
R9264:Ugt1a10 UTSW 1 87,983,393 (GRCm39) missense possibly damaging 0.62
R9475:Ugt1a10 UTSW 1 88,143,982 (GRCm39) missense probably damaging 1.00
S24628:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
X0013:Ugt1a10 UTSW 1 88,143,976 (GRCm39) missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 87,983,564 (GRCm39) missense probably benign 0.20
Z1190:Ugt1a10 UTSW 1 88,143,880 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCATCAGTGATCTTTGCAAGACTTTC -3'
(R):5'- AGCTCTCCTCATGTGCTAAAGC -3'

Sequencing Primer
(F):5'- CTACTATCTTGAAGAGGGTGCCCAG -3'
(R):5'- TGGGGAACTCCAACACAA -3'
Posted On 2015-08-18