Incidental Mutation 'R0105:Fam227a'
ID33283
Institutional Source Beutler Lab
Gene Symbol Fam227a
Ensembl Gene ENSMUSG00000042564
Gene Namefamily with sequence similarity 227, member A
Synonyms4933432B09Rik
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location79609576-79658956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79620832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 466 (D466G)
Ref Sequence ENSEMBL: ENSMUSP00000155261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109646] [ENSMUST00000109648] [ENSMUST00000187519] [ENSMUST00000191401] [ENSMUST00000229064] [ENSMUST00000230366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109646
AA Change: D114G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105273
Gene: ENSMUSG00000042564
AA Change: D114G

DomainStartEndE-ValueType
low complexity region 156 175 N/A INTRINSIC
low complexity region 204 211 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109648
AA Change: D470G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105275
Gene: ENSMUSG00000042564
AA Change: D470G

DomainStartEndE-ValueType
Pfam:FWWh 134 295 1.4e-51 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187519
AA Change: D470G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139524
Gene: ENSMUSG00000042564
AA Change: D470G

DomainStartEndE-ValueType
Pfam:FWWh 132 295 1e-47 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191401
Predicted Effect possibly damaging
Transcript: ENSMUST00000229064
AA Change: D466G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000230366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231122
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Dsg2 T C 18: 20,602,054 S1030P probably benign Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Fam227a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Fam227a APN 15 79634073 missense possibly damaging 0.66
IGL01807:Fam227a APN 15 79649655 missense probably benign 0.03
IGL01936:Fam227a APN 15 79612546 missense possibly damaging 0.90
IGL02355:Fam227a APN 15 79643938 intron probably benign
IGL02362:Fam227a APN 15 79643938 intron probably benign
IGL02569:Fam227a APN 15 79634122 missense probably benign
IGL02713:Fam227a APN 15 79636796 splice site probably benign
IGL02734:Fam227a APN 15 79617841 splice site probably benign
IGL02816:Fam227a APN 15 79626296 missense possibly damaging 0.66
IGL03354:Fam227a APN 15 79636750 missense possibly damaging 0.91
R0194:Fam227a UTSW 15 79640669 nonsense probably null
R0437:Fam227a UTSW 15 79643988 missense possibly damaging 0.90
R0786:Fam227a UTSW 15 79626268 missense probably benign 0.01
R0925:Fam227a UTSW 15 79620805 missense probably benign 0.04
R1200:Fam227a UTSW 15 79612537 missense possibly damaging 0.66
R1424:Fam227a UTSW 15 79634108 missense probably benign 0.34
R1474:Fam227a UTSW 15 79615381 missense probably damaging 0.97
R1495:Fam227a UTSW 15 79626245 missense probably benign 0.00
R1561:Fam227a UTSW 15 79636762 missense possibly damaging 0.95
R1661:Fam227a UTSW 15 79620677 intron probably null
R1669:Fam227a UTSW 15 79620677 intron probably null
R1967:Fam227a UTSW 15 79637134 missense possibly damaging 0.93
R1976:Fam227a UTSW 15 79626276 missense possibly damaging 0.83
R2197:Fam227a UTSW 15 79623467 missense probably damaging 0.97
R2230:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2231:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2232:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2910:Fam227a UTSW 15 79636734 missense possibly damaging 0.81
R3027:Fam227a UTSW 15 79648733 splice site probably null
R3943:Fam227a UTSW 15 79620859 splice site probably benign
R4811:Fam227a UTSW 15 79615427 missense possibly damaging 0.66
R4845:Fam227a UTSW 15 79649711 missense probably damaging 0.99
R4896:Fam227a UTSW 15 79637054 missense probably benign 0.32
R4934:Fam227a UTSW 15 79637061 missense possibly damaging 0.71
R4941:Fam227a UTSW 15 79640003 critical splice donor site probably null
R5225:Fam227a UTSW 15 79636735 missense possibly damaging 0.90
R5369:Fam227a UTSW 15 79615436 missense probably benign 0.27
R5593:Fam227a UTSW 15 79640058 utr 3 prime probably benign
R6311:Fam227a UTSW 15 79640694 missense probably benign 0.23
R6362:Fam227a UTSW 15 79643350 missense possibly damaging 0.53
R6532:Fam227a UTSW 15 79636720 missense probably benign 0.00
R7239:Fam227a UTSW 15 79634062 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCTGCTGACTGCTACAGTGGAC -3'
(R):5'- CAGCCATAGTGGTACAGCCTTTCTC -3'

Sequencing Primer
(F):5'- TACAGTGGACGGGGGTC -3'
(R):5'- TCGCCAGTCTGAGAAGACC -3'
Posted On2013-05-09