Mutagenetix > Incidental Mutation

Incidental Mutation 'R4515:Galnt3'

332830

Institutional Source

Beutler Lab

Gene Symbol

Galnt3

Ensembl Gene

ENSMUSG00000026994

Gene Name

polypeptide N-acetylgalactosaminyltransferase 3

Synonyms

ppGaNTase-T3

MMRRC Submission

041589-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R4515 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66082766-66124994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 66093610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 438 (R438L)

Ref Sequence

ENSEMBL: ENSMUSP00000028378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028378]

AlphaFold

P70419

Predicted Effect

probably damaging
Transcript: ENSMUST00000028378
AA Change: R438L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: R438L

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
coiled coil region	44	75	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	185	440	8.3e-10	PFAM
Pfam:Glycos_transf_2	188	374	1.2e-35	PFAM
Pfam:Glyco_transf_7C	345	423	7.7e-14	PFAM
RICIN	506	630	2.71e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150793

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155453

Meta Mutation Damage Score

0.6521

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chd3	G	T	11: 69,349,877	R1579S	probably benign	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Sec31a	A	G	5: 100,365,958	S993P	probably damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Sipa1l2	T	C	8: 125,492,226	D124G	probably benign	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Galnt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Galnt3	APN	2	66095284	missense	probably damaging	1.00
IGL01563:Galnt3	APN	2	66097757	missense	probably damaging	0.97
IGL01973:Galnt3	APN	2	66084262	missense	probably benign	0.03
IGL02004:Galnt3	APN	2	66095926	missense	probably damaging	1.00
IGL02424:Galnt3	APN	2	66095788	critical splice donor site	probably null
IGL02946:Galnt3	APN	2	66095218	missense	probably damaging	0.99
IGL03059:Galnt3	APN	2	66093610	missense	probably damaging	1.00
PIT4531001:Galnt3	UTSW	2	66107088	missense	probably benign	0.03
R0437:Galnt3	UTSW	2	66107229	missense	possibly damaging	0.74
R1390:Galnt3	UTSW	2	66091223	missense	probably damaging	1.00
R1536:Galnt3	UTSW	2	66084206	missense	probably damaging	1.00
R1869:Galnt3	UTSW	2	66097779	missense	possibly damaging	0.82
R2987:Galnt3	UTSW	2	66084241	missense	probably benign	0.00
R3973:Galnt3	UTSW	2	66107030	missense	possibly damaging	0.77
R4039:Galnt3	UTSW	2	66085327	missense	probably damaging	0.96
R4518:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4519:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4577:Galnt3	UTSW	2	66097859	missense	probably benign	0.02
R4817:Galnt3	UTSW	2	66093539	missense	possibly damaging	0.83
R5008:Galnt3	UTSW	2	66085241	missense	probably benign	0.04
R5191:Galnt3	UTSW	2	66093706	missense	probably damaging	1.00
R5947:Galnt3	UTSW	2	66084156	utr 3 prime	probably benign
R6534:Galnt3	UTSW	2	66102531	missense	probably damaging	1.00
R7196:Galnt3	UTSW	2	66090924	missense	probably damaging	1.00
R7817:Galnt3	UTSW	2	66095899	missense	probably damaging	1.00
R7951:Galnt3	UTSW	2	66097842	missense	probably benign	0.00
R7952:Galnt3	UTSW	2	66097842	missense	probably benign	0.00
R8071:Galnt3	UTSW	2	66091211	missense	probably benign	0.28
R8513:Galnt3	UTSW	2	66093720	nonsense	probably null
R8844:Galnt3	UTSW	2	66085292	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTATACACAGGCCTGCCAAG -3'
(R):5'- CGTAGAGACTATATGACATACCAGTAC -3'

Sequencing Primer
(F):5'- CCATCTTGATGGTCAAAGTCAAAGGC -3'
(R):5'- GAGCAACAGTTTGTTTTTCCCACAAG -3'

Posted On

2015-08-18