Incidental Mutation 'R4515:Galnt3'
ID332830
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Namepolypeptide N-acetylgalactosaminyltransferase 3
SynonymsppGaNTase-T3
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66082766-66124994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66093610 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 438 (R438L)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
Predicted Effect probably damaging
Transcript: ENSMUST00000028378
AA Change: R438L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: R438L

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155453
Meta Mutation Damage Score 0.6521 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 66095284 missense probably damaging 1.00
IGL01563:Galnt3 APN 2 66097757 missense probably damaging 0.97
IGL01973:Galnt3 APN 2 66084262 missense probably benign 0.03
IGL02004:Galnt3 APN 2 66095926 missense probably damaging 1.00
IGL02424:Galnt3 APN 2 66095788 critical splice donor site probably null
IGL02946:Galnt3 APN 2 66095218 missense probably damaging 0.99
IGL03059:Galnt3 APN 2 66093610 missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 66107088 missense probably benign 0.03
R0437:Galnt3 UTSW 2 66107229 missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 66091223 missense probably damaging 1.00
R1536:Galnt3 UTSW 2 66084206 missense probably damaging 1.00
R1869:Galnt3 UTSW 2 66097779 missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 66084241 missense probably benign 0.00
R3973:Galnt3 UTSW 2 66107030 missense possibly damaging 0.77
R4039:Galnt3 UTSW 2 66085327 missense probably damaging 0.96
R4518:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4519:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4577:Galnt3 UTSW 2 66097859 missense probably benign 0.02
R4817:Galnt3 UTSW 2 66093539 missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 66085241 missense probably benign 0.04
R5191:Galnt3 UTSW 2 66093706 missense probably damaging 1.00
R5947:Galnt3 UTSW 2 66084156 utr 3 prime probably benign
R6534:Galnt3 UTSW 2 66102531 missense probably damaging 1.00
R7196:Galnt3 UTSW 2 66090924 missense probably damaging 1.00
R7817:Galnt3 UTSW 2 66095899 missense probably damaging 1.00
R8071:Galnt3 UTSW 2 66091211 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGTATACACAGGCCTGCCAAG -3'
(R):5'- CGTAGAGACTATATGACATACCAGTAC -3'

Sequencing Primer
(F):5'- CCATCTTGATGGTCAAAGTCAAAGGC -3'
(R):5'- GAGCAACAGTTTGTTTTTCCCACAAG -3'
Posted On2015-08-18